Grin2a (NM_012573) Rat Untagged Clone

CAT#: RN214669

Grin2a (untagged ORF) - Rat glutamate receptor, ionotropic, N-methyl D-aspartate 2A (Grin2a), (10 ug)

USD 2,328.00


Availability*
7 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Grin2a (NM_012573) Rat Untagged Clone
Symbol Grin2a
Synonyms GluN2A; NMDAR2A; NR2A
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>RN214669 representing NM_012573
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCAGATTGGGCTACTGGACCTTGCTGGTATTGCCGGCCCTTCTGGTCTGGCGCGATCCGGCGCAGA
ACGCGGCGGCGGAGAAGGGTCCTCCAGCGCTGAACATTGCGGTGCTGCTGGGTCACAGCCACGACGTGAC
AGAACGCGAACTTCGAAATCTGTGGGGCCCAGAGCAGGCAACCGGCTTGCCCCTGGATGTGAACGTGGTG
GCGTTATTGATGAACCGCACTGACCCTAAGAGCCTCATCACGCATGTGTGCGACCTCATGTCCGGGGCGC
GCATCCACGGCTTGGTGTTTGGAGATGACACGGACCAGGAGGCTGTGGCCCAGATGCTGGATTTTATCTC
CTCACAGACTTTTATCCCCATCTTGGGCATTCATGGGGGTGCATCTATGATCATGGCTGACAAGGATCCG
ACATCCACGTTCTTCCAGTTTGGAGCCTCCATCCAGCAGCAAGCCACAGTTATGCTGAAGATCATGCAGG
ACTACGACTGGCACGTCTTCTCCCTGGTCACCACCATCTTCCCTGGCTACCGAGACTTCATCAGCTTTAT
CAAGACAACAGTGGACAACAGCTTTGTGGGCTGGGATATGCAGAACGTGATCACACTGGACACCTCCTTC
GAGGACGCCAAGACGCAGGTCCAGCTGAAGAAGATCCATTCTTCTGTCATCCTGCTCTACTGCTCCAAAG
ACGAGGCTGTCCTCATCCTGAGCGAGGCTCGCTCCCTCGGCCTCACTGGCTATGATTTCTTCTGGATTGT
CCCCAGTTTGGTGTCTGGGAACACAGAGCTCATCCCCAAAGAGTTTCCATCAGGTCTCATTTCAGTCTCT
TATGACGACTGGGACTACAGCCTGGAGGCAAGAGTGAGAGACGGTCTTGGGATCTTAACCACTGCCGCAT
CCTCCATGTTGGAGAAGTTCTCCTACATTCCTGAGGCCAAGGCCAGCTGCTATGGGCAGGCAGAGAAGCC
AGAGACCCCGCTACACACCCTGCACCAATTCATGGTCAATGTGACTTGGGATGGCAAGGACTTGTCCTTC
ACTGAGGAAGGTTACCAGGTGCACCCCAGGCTTGTGGTGATCGTGCTGAACAAGGACCGGGAGTGGGAAA
AGGTGGGCAAGTGGGAGAACCAGACGCTGAGCCTGAGGCACGCTGTGTGGCCAAGGTACAAGTCCTTTTC
TGACTGCGAGCCAGATGACAACCACCTCAGCATTGTCACCTTGGAGGAAGCCCCCTTCGTCATCGTAGAG
GACATAGACCCCCTGACTGAGACCTGTGTGAGGAACACGGTGCCCTGTCGGAAGTTCGTCAAGATCAACA
ATTCAACCAACGAAGGGATGAATGTGAAGAAATGCTGCAAGGGGTTCTGCATCGACATCCTCAAGAAGCT
GTCCAGAACTGTGAAGTTCACCTATGACCTCTACCTGGTGACCAATGGGAAGCATGGGAAAAAGGTTAAC
AATGTGTGGAATGGAATGATAGGTGAAGTGGTCTATCAACGAGCAGTCATGGCTGTGGGCTCACTCACCA
TCAATGAGGAGCGTTCGGAAGTGGTGGACTTCTCGGTGCCCTTCGTGGAGACAGGAATCAGCGTCATGGT
CTCCAGGAGTAATGGCACTGTCTCCCCTTCTGCTTTCCTCGAACCCTTCAGTGCCTCCGTCTGGGTGATG
ATGTTTGTGATGCTGCTCATCGTCTCAGCCATTGCTGTCTTCGTTTTTGAATACTTCAGTCCTGTTGGAT
ACAACAGAAACTTAGCCAAAGGGAAAGCTCCCCACGGGCCTTCTTTTACTATTGGAAAAGCTATATGGCT
CCTCTGGGGCCTGGTCTTCAACAATTCTGTGCCTGTCCAGAATCCTAAAGGCACAACCAGCAAGATCATG
GTGTCAGTGTGGGCCTTCTTTGCTGTCATCTTCCTGGCCAGTTACACAGCCAACCTGGCTGCCTTCATGA
TCCAGGAGGAGTTTGTGGACCAAGTGACTGGCCTCAGTGACAAGAAGTTCCAGAGACCTCATGACTATTC
TCCACCTTTCCGATTTGGGACGGTACCCAATGGAAGTACAGAGAGGAATATTCGTAACAACTACCCGTAT
ATGCACCAGTACATGACCAGATTCAACCAGAGGGGAGTGGAGGATGCCTTGGTCAGCTTGAAAACCGGGA
AGTTGGACGCTTTCATCTATGACGCAGCCGTCTTGAACTACAAGGCCGGGAGGGATGAAGGCTGTAAACT
GGTGACCATTGGGAGCGGGTACATCTTTGCTACCACAGGCTATGGAATTGCGCTGCAGAAGGGCTCACCC
TGGAAGAGGCAGATTGACCTCGCTCTGCTCCAGTTTGTTGGTGATGGTGAGATGGAGGAGCTGGAGACAC
TGTGGCTTACGGGCATCTGCCACAACGAGAAGAATGAGGTGATGAGTAGCCAGCTGGACATCGATAACAT
GGCGGGCGTGTTCTACATGCTGGCTGCAGCCATGGCCCTCAGCCTCATCACCTTCATCTGGGAGCACCTC
TTCTACTGGAAGCTGCGCTTCTGCTTCACAGGCGTGTGCTCTGACCGGCCCGGGCTGCTCTTCTCCATCA
GCAGGGGCATCTATAGTTGCATCCATGGGGTACACATTGAAGAAAAGAAGAAATCTCCAGATTTCAATCT
GACTGGATCACAGAGCAACATGCTAAAGCTTCTTCGGTCAGCTAAAAACATCTCCAATATGTCCAACATG
AACTCCTCAAGAATGGACTCACCTAAAAGAGCTACTGACTTCATTCAAAGAGGGTCACTTATTGTGGACA
TGGTTTCAGACAAGGGAAATTTGATATATTCAGACAACAGATCCTTTCAAGGGAAGGACAGTATATTTGG
AGACAACATGAATGAACTCCAAACATTTGTGGCCAACAGGCACAAGGATAATCTCAGTAACTATGTGTTT
CAAGGACAGCATCCTCTCACTCTCAATGAGTCCAACCCTAACACAGTAGAGGTGGCTGTCAGCACTGAAT
CCAAAGGGAACTCCCGACCCCGGCAGCTTTGGAAGAAATCCATGGAGTCTCTACGCCAGGATTCTCTAAA
CCAGAACCCAGTCTCCCAGAGGGATGAGAAGACTGCAGAGAATCGGACCCACTCGCTAAAGAGTCCTAGG
TATCTTCCAGAAGAGGTAGCCCACTCTGACATTTCAGAAACCTCAAGCCGGGCCACATGCCACAGGGAGC
CAGATAACAATAAGAACCACAAGACCAAGGATAACTTCAAACGGTCAATGGCCTCTAAGTATCCCAAGGA
CTGTAGCGATGTTGACCGCACCTACATGAAAACCAAAGCAAGTTCTCCCAGGGATAAGATCTATACCATT
GATGGTGAGAAGGAGCCCAGCTTCCACTTAGATCCTCCTCAGTTTGTTGAGAATATAACCCTGCCTGAGA
ATGTGGGCTTCCCAGATACCTACCAAGATCACAATGAGAACTTCCGCAAGGGGGACTCCACACTGCCCAT
GAACAGGAACCCATTACATAATGAAGACGGGCTTCCCAACAATGACCAATATAAACTCTATGCCAAGCAC
TTTACCTTGAAAGACAAGGGTTCCCCACACAGTGAGGGCAGTGATCGATACCGGCAGAACTCCACACATT
GCAGAAGCTGCCTTTCGAATCTGCCCACCTACTCAGGCCACTTTACCATGAGGTCTCCTTTCAAGTGTGA
TGCCTGTCTGCGGATGGGGAATCTCTATGACATTGATGAAGACCAGATGCTTCAGGAGACAGGTAACCCA
GCTACTCGGGAGGAGGTCTACCAGCAGGACTGGTCACAGAACAACGCCCTCCAGTTCCAGAAGAACAAGC
TAAGGATTAACCGACAGCACTCCTATGATAACATTCTGGACAAACCCAGAGAGATAGACCTTAGCAGGCC
CTCCCGGAGCATAAGCCTCAAGGACAGGGAACGGCTACTGGAGGGCAACTTGTATGGGAGCCTGTTCAGT
GTCCCCTCAAGCAAACTCTTGGGGAACAAAAGCTCCCTTTTCCCCCAAGGTCTGGAGGACAGCAAGAGGA
GCAAGTCTCTCTTGCCAGACCACGCCTCCGATAATCCTTTCCTCCACACGTATGGGGATGACCAACGCTT
AGTTATCGGGAGATGTCCCTCGGACCCTTACAAACACTCATTGCCATCACAGGCGGTAAATGACAGCTAT
CTTCGGTCATCCTTGAGGTCAACAGCATCATATTGCTCCAGGGACAGTCGGGGCCACAGTGATGTGTATA
TTTCAGAGCATGTTATGCCTTATGCTGCAAATAAGAATACCATGTACTCTACCCCCAGGGTTTTAAATTC
CTGCAGCAATAGACGAGTGTACAAGAAAATGCCTAGTATCGAATCTGATGTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_012573
ORF Size 4395 bp
Insert Size 4395
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_012573.3, NP_036705
RefSeq Size 4717
Locus ID 24409
Cytogenetics 10q11
Gene Summary may play a role in synaptic transmission, learning and memory [RGD, Feb 2006]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.