Senp2 (NM_023989) Rat Untagged Clone

CAT#: RN214514

Senp2 (untagged ORF) - Rat SUMO1/sentrin/SMT3 specific peptidase 2 (Senp2), (10 ug)


  "NM_023989" in other vectors (3)

Reconstitution Protocol

USD 603.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Senp2"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Senp2
Synonyms Axam
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214514 representing NM_023989
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTACAGATGGCTGACTAAGGTTCTCGGCACCATTCTTCGCTTGTGTGAGCGGCCCGCGCCCGGGGCCC
GCGCCCTGCTCAAGAGGCGGCGCTCCAGCAGCTCTCTGTTTTCTACTGCAGTGGACACTGATGAAATCCC
AGCTAAAAGACCAAGACTAGATTGCTTCATTCACCAAGTGAAGAACAGTCTCTACAATGCGGCCAGCTTA
TTTGGATTCCCATTCCAGCTGACCACCAAACCCATGGTGTCTTCTGCTTGTAATGGAACACGGAATGTGG
CCCCTTCAGGAGAGGTGTTCTCGAACTCTCCCTCCTGTGAACTGACGACTTCTGGATCCTGCAGCAGCAT
GCTGAAGCTGGGTAATAAATCTCCTAATGGAATAAGTGACTATCCAAAGATCAGAGTGACAGTGGCCCGA
GATCAGCCACGGAGAGTCCTGCCTTCCTTTGGTTTTACATTGAAATCAGAAGGCTATAATAGAAGACCAA
GTGGCCGTCGCCATAGCAAAAGCAATCCAGAGAGTTCCTTACCGTGGAAACCTCAGGAGCAAGGTGTAAC
AGAGATGATTTCTGAAGAGGGTGGCAAGGGTGCAAGGCGTCCCCATTGCACCGTGGAGGAGGGTGTCCAA
AAGGACGAAAGAGAAAAATACCTAAAGTTATTGGAGCGTCTTAAAGAGGGTGCTCACGGAAGCACTTTTC
CTCCTGCAGTTTCACATCATAGTTCTCAGAGAACGCAGATGGACACATTAAAGACCAAAGGCTGGATGGA
AGAACAGAATCATGGAGTCAGAACAACCCATTTGGTTCCCAAACAGTATAGAGTTGTTGAAACAAGAGGA
CCTCTCTGTTCAGTGAGAAGTGAAAAGAGGTATTCAAAAGGAAAAGCTGACACAGAGAAGGTGGTGGGAC
TCCGATTTGAAAAGGACGGTACAAGAGGACACCAGTTGGAGCCTGATCTGTCAGAAGAAGTGTCTGCCCG
GCTTCGCCTGGGAAGTGGAAGCAATGGCCTACTCAGAAGGAAAATATCAGTGCTTGAGGCAAAGGAAAAG
AACTTCCCAAGCAAAGAGAAGGACAGAAGAACAGAAGATCTCTTTGAACTTACAGAGGACATGGAAAAGG
AAATCAGTAATGCCCTGGGCCATGGTCCTCCAGATGAGATTTTGAGCAGCGCTTTCAAGTTACGAATCAC
CCGTGGAGATATCCAGACCTTAAAGAACTATCACTGGCTCAATGATGAGGTCATTAATTTTTATATGAAT
CTTTTAGTGGAGAGGAGTAAAAAGCAAGGCTACCCAGCACTTCATGCACTCAGTACATTCTTCTATCCTA
AATTAAAGTCTGGAGGTTACCAAGCAGTGAAAAGATGGACCAAAGGGGTGAATCTCTTCGATCAAGAACT
TGTTCTGGTTCCTATTCATCGGAAGGTACATTGGAGCCTGGTGGTGATGGACCTAAGAAAAAAGTGTCTT
AAATATCTGGATTCTATGGGACAAAAAGGCCACAGGATCTGTGAGATTCTTCTTCAGTATTTACAGGACG
AAAGCAAGACCAAAAGAAATACAGATCTCAATCTCTTAGAGTGGACCCACTACAGCATGAAGCCACATGA
GATTCCTCAACAGTTGAATGGGAGTGATTGTGGAATGTTTACTTGTAAATACGCAGATTATATTTCTAGG
GACAAACCTATCACATTCACTCAGCACCAGATGCCTCTCTTCCGGAAGAAGATGGTGTGGGAAATCCTTC
ACCAGCAGTTGCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_023989
Insert Size 1767 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_023989.1, NP_076479.1
RefSeq Size 1808 bp
RefSeq ORF 1767 bp
Locus ID 78973
UniProt ID Q9EQE1
Cytogenetics 11q23
Gene Summary binds the GSK-3beta interacting protein Axin; inhibits the Wnt signalling pathway via inhibition of Axin protein complex formation [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.