Kcnab1 (NM_017303) Rat Untagged Clone

CAT#: RN214330

Reviews ()
Write a review

Kcnab1 (untagged ORF) - Rat potassium voltage-gated channel, shaker-related subfamily, beta member 1 (Kcnab1), (10 ug)


  View "NM_017303" in other vectors (5)

USD 420.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Kcnab1 (NM_017303) Rat Untagged Clone
Type Rat Untagged Clone
Tag Tag Free
Symbol Kcnab1
Synonyms KvBeta3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>RN214330 representing NM_017303
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAAGTCTCCATAGCCTGCACAGAGCACAATTTGAAGAGTCGAAATGGTGAGGACCGACTTCTGAGCA
AGCAGAGCTCCACCGCCCCCAATGTGGTGAACGCAGCCCGGGCCAAATTCCGCACTGTCGCTATCATCGC
TCGCAGCCTGGGGACCTTCACCCCTCAGCATCACATTTCTCTCAAAGAGTCCACTGCAAAGCAGACTGGC
ATGAAATATAGGAATCTTGGGAAATCAGGACTCAGAGTTTCGTGCTTGGGTCTTGGAACATGGGTGACAT
TCGGAGGTCAAATTTCAGATGAGGTTGCTGAACGGCTGATGACAATTGCCTATGAGAGTGGAGTTAATCT
CTTCGACACTGCAGAAGTCTATGCTGCTGGGAAGGCTGAGGTGATTCTGGGGAGCATCATCAAGAAGAAA
GGCTGGAGGAGGTCAAGCTTGGTCATCACAACCAAACTCTACTGGGGTGGAAAAGCCGAAACAGAAAGAG
GATTGTCAAGAAAGCACATCATTGAAGGACTGAAAGGCTCCCTCCAGAGGCTGCAACTGGAATATGTGGA
CGTGGTCTTTGCAAATCGCCCAGACAGCAACACCCCCATGGAAGAAATCGTTCGAGCCATGACGCACGTG
ATCAACCAAGGCATGGCAATGTACTGGGGCACCTCGAGGTGGAGCGCGATGGAGATCATGGAAGCCTACT
CTGTCGCGCGGCAGTTCAACATGATCCCGCCTGTCTGTGAGCAAGCTGAGTATCATCTTTTCCAGAGAGA
AAAGGTGGAGGTCCAGCTGCCAGAGCTCTACCATAAAATAGGGGTTGGTGCAATGACATGGTCTCCACTT
GCTTGTGGAATTATTTCAGGAAAATATGGAAATGGGGTGCCAGAAAGTTCTAGAGCTTCACTGAAGTGCT
ACCAGTGGTTGAAGGAAAGGATTGTAAGTGAAGAAGGGAGAAAACAGCAAAACAAGCTGAAAGACCTCTC
TCCAATTGCTGAACGCCTGGGATGCACACTACCTCAGCTGGCTGTGGCATGGTGCCTGAGAAACGAGGGT
GTGAGCTCTGTGCTGCTGGGATCATCCACTCCTGAACAACTCATTGAAAACCTTGGTGCCATTCAGGTCC
TCCCTAAGATGACATCACATGTGGTAAATGAGATTGATAACATATTGCGCAACAAGCCCTACAGCAAAAA
GGACTATAGATCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_017303
ORF Size 1206 bp
Insert Size 1206
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_017303.2, NP_058999.1
RefSeq Size 3522
RefSeq ORF 1206
Locus ID 29737
Cytogenetics 2q31
Gene Summary beta subunit of potassium channel involved in alteration of channel activation kinetics [RGD, Feb 2006]

Other Versions

Other products for "Kcnab1"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones