Anxa6 (NM_024156) Rat Untagged Clone

CAT#: RN213827

Reviews ()
Write a review

Anxa6 (untagged ORF) - Rat annexin A6 (Anxa6), (10 ug)

  View "NM_024156" in other vectors (5)

USD 910.00


Availability*
5 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Anxa6 (NM_024156) Rat Untagged Clone
Type Rat Untagged Clone
Tag Tag Free
Symbol Anxa6
Synonyms Anx6; CPB-II
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>RN213827 representing NM_024156
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAAAATAGCACAGGGTGCCATGTACCGAGGCTCTGTCCACGACTTCGCAGACTTTGATGCAAATC
AGGATGCCGAGGCTTTGTACACAGCCATGAAGGGCTTCGGCAGTGACAAGGAGTCCATATTGGAGCTGAT
CACCTCCCGCAGCAACAAGCAGAGGCAGGAGATCTGCCAGAGTTACAAGTCCCTCTATGGCAAGGACCTC
ATCGCAGACTTGAAGTATGAGTTGACAGGGAAGTTCGAGCGACTGATAGTGAACCTGATGAGGCCGCTTG
CCTATTGTGACGCCAAAGAGATTAAAGACGCTATCTCGGGCATTGGCACTGATGAGAAGTGCCTCATTGA
AATTTTGGCTTCCCGGACCAATGAGCAGATACACCAGCTGGTGGCCGCATACAAAGATGCCTATGAGAGA
GACCTGGAGTCTGACATCATTGGAGACACTTCAGGCCACTTCCAGAAGATGCTGGTGGTACTGCTCCAGG
GAACCCGGGAGAATGACGATGTTGTGAGTGAGGACTTGGTCCAGCAGGATGTCCAGGACCTGTATGAGGC
AGGGGAATTGAAATGGGGAACAGATGAGGCCCAGTTCATCTATATCTTGGGAAACCGTAGCAAACAGCAC
CTACGATTGGTGTTTGATGAGTACCTGAAGACCACAGGGAAGCCCATCGAAGCCAGTATCAGAGGGGAGC
TGTCTGGAGACTTTGAGAAGCTGATGTTGGCCGTGGTGAAGTGCATCCGAAGTACCCCGGAGTATTTTGC
TGAAAGGCTGTTCAAAGCCATGAAGGGCCTGGGGACTCGAGACAACACTCTGATCCGTATCATGGTCTCC
AGGAGCGAACTGGATATGCTTGACATCCGGGAGATCTTCCGGACCAAGTATGAGAAGTCACTCTACAGCA
TGATCAAGAATGATACCTCTGGTGAATACAAGAAGGCTTTGCTGAAGCTATGTGGAGGGGACGATGATGC
CGCTGGCCAGTTCTTCCCGGAGGCAGCACAGGTGGCCTATCAGATGTGGGAACTTAGTGCAGTGTCCCGA
GTCGAGCTGAAGGGTACCGTGCGTGCGGCCAACGATTTCAACCCCGATGCTGATGCCAAGGCCCTGCGGA
AAGCCATGAAGGGAATTGGAACCGACGAAGCCACCATCATCGACATCATCACACAGCGCAGCAACGCCCA
GCGGCAGCAGATCCGGCAGACCTTCAAATCTCACTTTGGCCGGGATTTAATGGCCGACCTGAAGTCCGAG
ATCTCAGGAGACCTGGCAAGGCTGATCCTGGGGCTCATGATGCCACCTGCCCATTACGATGCTAAGCAGC
TGAAGAAAGCTATGGAGGGAGCCGGCACAGATGAAAAGGCTCTTATAGAAATCCTGGCCACCCGGACCAA
TGCTGAAATCCGAGCCATCAATGAGGCCTACAAGGAGGATTATCACAAGTCCCTGGAGGATGCCCTGAGC
TCGGACACATCTGGCCACTTCAAAAGGATCCTCATTTCTCTGGCCACAGGGAATCGAGAGGAAGGAGGAG
AAAACCGGGACCAGGCTCAGGAAGATGCTCAGGTGGCTGCTGAGATCTTGGAAATAGCAGACACACCCAG
TGGAGACAAAACCTCCTTGGAGACTCGATTCATGACCGTCCTGTGCACCCGTAGCTATCCCCACCTGCGC
AGAGTCTTCCAGGAGTTCATCAAGAAAACCAACTATGACATAGAGCATGTCATCAAGAAGGAGATGTCTG
GGGACGTCAAGGACGCATTTGTGGCCATCGTTCAGAGTGTCAAGAACAAGCCTCTCTTCTTTGCTGACAA
ACTGTACAAGTCCATGAAGGGTGCCGGCACGGATGAGAAGACCCTCACCAGGGTGATGGTGTCCCGGAGT
GAGATAGACCTGCTCAACATCCGGAGGGAATTCATTGAGAAATATGACAAGTCTCTACACCAAGCCATTG
AAGGTGACACCTCTGGAGACTTCATGAAGGCTTTGCTGGCGCTCTGTGGTGGAGAAGACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_024156
ORF Size 2022 bp
Insert Size 2022
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_024156.2, NP_077070.2
RefSeq Size 2625
RefSeq ORF 2022
Locus ID 79125
Cytogenetics 10q22
Gene Summary Ca(2+)-sensitive phospholipid-binding protein that binds CRHSP-28 [RGD, Feb 2006]

Other Versions

Other products for "Anxa6"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones