Taok3 (NM_001024254) Rat Untagged Clone

CAT#: RN213390

Reviews ()
Write a review

Taok3 (untagged ORF) - Rat TAO kinase 3 (Taok3), (10 ug)



Reconstitution Protocol

USD 905.00

6 Weeks*

Size
    • 10 ug

Product images

Other products for "Taok3"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Taok3
Synonyms JIK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213390 representing NM_001024254
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGTAAAGGAGTGCTGAAGGACCCCGAGATTGCCGAGCTGTTCTTCAAGGAGGACCCCGAAGAGCTCT
TTATCGACCTGCATGAAATCGGACATGGCAGCTTTGGAGCCGTGTACTTCGCAACTAATGCGCACACCAA
CGAGGTGGTTGCTATTAAGAAAATGTCCTACAGTGGGAAGCAGACCCACGAGAAATGGCAAGATATCCTG
AAGGAAGTTCGATTCCTCCAGCAGCTGAAGCACCCGAACACCATCGAGTACAAAGGCTGTTATTTAAAGG
AGCACACCGCTTGGTTGGTGATGGAGTACTGCTTAGGTTCAGCCTCTGACTTGTTAGAAGTTCATAAGAA
ACCACTTCAGGAAGTAGAGATTGCTGCTATCACCCATGGTGCCTTGCAGGGGCTGGCCTACCTCCACTTT
CACTCCCTGATTCACAGGGACATTAAAGCAGGGAATATCCTCCTCACAGAGCCAGGCCAGGTGAAGCTGG
CTGACTTCGGGTCCGCTTCCATGGCTTCTCCTGCCAACTCCTTCGTGGGGACTCCTTACTGGATGGCCCC
AGAGGTGATCTTAGCCATGGACGAAGGGCAGTACGACGGGAAAGTTGACATCTGGTCACTCGGCATCACC
TGCATAGAGCTGGCGGAGCGGAAGCCCCCCCTCTTCAACATGAACGCCATGAGCGCCCTCTACCACATCG
CTCAGAATGACTCCCCCACGCTGCAGTCCAGAGAATGGACAGACTCCTTCAGGAGATTCGTTGATTACTG
CTTGCACAAAATACCTCAGGAACGACCAGCCGCGGCGGAACTGTTGCGGCACGACTTCATTCGGAGGGAG
CGGCCGCCGAGGGTCCTCATTGACCTCATACAGAGGACGAAAGATGCTGTCCGAGAGCTGGACAACCTGC
AGTACAGGAAAATGAAGAAGATCCTCTTCCAGGAGACTCGGAACGGACCCCTGAATGAGTCACAAGAAGA
GGAAGAAGACAGTGAGCAAGGAAGCAACCTGAACCGAGAGGTGGACAGTCTGGGGAGCATCCACTCCATC
CCCAGCGTGTCAGTGAGCACGGGCAGCCGGAGCAGCAGCGTGAACAGCATGCAGGAGGTCATGGACGAGG
GCAGCCCTGAGCTCGTCATGATGCAGGAGGATGAAGGCACAGTCAACTCCAGCTCCTCTATGGTACACAA
GAAGGATCATGTATTCGTAAGGGATGAGGCGGGCCACGGCGATCCCAGGCCTGAGCCGCGGCCTACCCAG
TCAGTTCAGAGCCGGGCCCTCCACTATCGGAACCGAGAGCGCTTTGCCACGATCAAATCCGCGTCTTTGG
TTACACGGCAGATCCACGAGCATGAGCAGGAGAACGAGCTGCGGGAACAGATGTCAGGTTATAAGCGGAT
GCGGCGCCAGCACCAGAAGCAGCTGATCGCCCTGGAGAACAAGCTGAAGGCTGAGATGGATGAGCACCGC
CTCAAGCTCCAGAAGGAGGTGGAGACGCATGCCAACAACTCGTCCATCGAGCTGGAGAAGCTGGCCAAGA
AGCAAGTGGCTACCATAGAAAAGGAGGCAAAGGTAGCCGCAGCGGATGAGAAGAAGTTCCAGCAGCAGAT
CCTGGCCCAGCAGAAGAAGGACTTGACAACTTTCTTAGAAAGTCAGAAGAAGCAGTACAAGATTTGTAAG
GAGAAAATAAAAGAGGAAATGAACGAGGACCATAGCACACCCAAGAAGGAGAAGCAGGAGCGCATATCGA
AGCATAAAGAGAACCTGCAGCACACGCAGGCCGAGGAGGAAGCCCACCTGCTCACGCAACAGAGGCTGTA
CTACGACAGAAACTGCCGCTGCTTCAAGCGGAAAATAATGACCAAGCGCCACGAGGTGGAACAGCAGAAC
ATTCGGGAGGAACTAAATAAAAAGAGGACCCAGAAAGAAATGGAGCACGCCATGCTGATCCGGCATGATG
AATCCACCCGAGAGCTCGAGTACAGACAGCTGCACACACTGCAGAAGCTCCGCATGGACCTGATCCGGTT
ACAGCACCAGACTGAGCTGGAGAACCAGCTGGAGTACAATAAGAGGCGGGAGCGGGAGCTGCACCGGAAG
CACGTCATGGAGCTTCGGCAACAGCCGAAAAACTTAAAGGCCATGGAAATGCAAATTAAAAAGCAGTTTC
AGGACACTTGCAAAGTACAGACCAAACAGTACAAAGCACTCAAAAACCACCAGTTGGAAGTCACTCCAAA
GAATGAGCACAAAGCAATCCTAAAGACACTGAAGGAGGAGCAGACGAGGAAGCTGGCCATCTTGGCCGAG
CAGTATGAACAGAGTATAAACGAGATGATGGCCTCTCAAGCGTTACGGCTAGACGAGGCGCAAGAGGCAG
AATGCCAGGCCTTGAGACTACAGCTCCAGCAGGAGATGGAGCTGCTCAACGCCTACCAGAGCAAAATCAA
GATGCAAACGGAGGCCCAGCACGAGCGCGAGCTGCAGAAGCTAGAGCAGAGGGTGTCCCTGCGCAGAGCG
CATCTTGAGCAGAAGATTGAAGAGGAGCTGGCCGCCCTGCAGAAGGAACGCAGTGAGAGGATCAAGACTC
TCCTGGAAAGACAAGAGCGAGAGACCGAGACTTTTGACATGGAGAGCCTCAGAATGGGGTTTGGGAATTT
GGTGACATTAGATTTTCCTAAGGAGGACTATAGATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001024254
Insert Size 2697 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001024254.1, NP_001019425.1
RefSeq Size 2820 bp
RefSeq ORF 2697 bp
Locus ID 304530
UniProt ID Q53UA7
Cytogenetics 12q16
Gene Summary Serine/threonine-protein kinase that acts as a regulator of the p38/MAPK14 stress-activated MAPK cascade and of the MAPK8/JNK cascade. Acts as an activator of the p38/MAPK14 stress-activated MAPK cascade. In response to DNA damage, involved in the G2/M transition DNA damage checkpoint by activating the p38/MAPK14 stress-activated MAPK cascade, probably by mediating phosphorylation of upstream MAP2K3 and MAP2K6 kinases. Inhibits basal activity of MAPK8/JNK cascade and diminishes its activation in response epidermal growth factor (EGF) (By similarity).[UniProtKB/Swiss-Prot Function]
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.