Gpr89b (NM_001139486) Rat Untagged Clone

CAT#: RN213252

Gpr89b (untagged ORF) - Rat G protein-coupled receptor 89 (Gpr89), (10 ug)

USD 577


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gpr89b (NM_001139486) Rat Untagged Clone
Symbol Gpr89b
Synonyms Gpr89; RGD1304837
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>RN213252 representing NM_001139486
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCTTCTTGATCGACTCCAGCATCATGATCACCTCCCAGATACTGTTCTTTGGATTCGGGTGGCTTT
TCTTCATGCGCCAGTTGTTTAAGGACTATGAGGTTCGTCAGTATGTGGTGCAGGTGATCTTCTCCGTGAC
CTTTGCGTTTTCCTGCACCATGTTCGAGCTTATCATCTTTGAAATCTTGGGAGTTCTGAACAGCAGCTCC
CGTTACTTTCACTGGAAAATGAACCTGTGTGTCATTCTGCTCATCCTGGTTTTCATGGTTCCCTTCTACA
TTGGTTATTTTATCGTGAGTAACATCCAACTGTTGCACAAACAGCGTCTGCTCTTTTCCTGTCTCTTATG
GCTGACCTTTATGTACTTCTTCTGGAAGCTGGGAGATCCATTCCCCATACTCAGCCCAAAACATGGGATC
TTGTCCATAGAGCAGCTCATCAGCCGGGTAGGTGTGATTGGGGTGACACTCATGGCTCTGCTTTCCGGAT
TCGGTGCTGTCAACTGCCCCTACACATACATGTCCTACTTCCTCAGGAATGTGACTGACACGGATATCCT
TGCCCTGGAACGGCGACTGCTGCAGACCATGGACATGATCATAAGCAAAAAGAAAAGGATGGCGGTGACC
CGGAGAACAATGTTCCAGAGGGGGGATGTGCAGAACAAGCCATCGGGACTCTGGGGCATGCTGAAGAGTG
TCACTGCCTCGGCCCCAGGAAGTGAAAATCTGACTCTTATCCAACAGGAAGTAGATGCTTTAGAAGAACT
GAGCAGGCAGCTTTTCCTGGAAACAGCCGATCTGTATGCTACAAAGGAAAGAATTGAATACTCCAAAACA
TTCAAGGGGAAATATTTTAATTTCCTGGGTTATTTTTTCTCTATTTATTGTGTCTGGAAAATTTTTATGG
CAACCATCAATATTGTTCTTGATCGGGTTGGGAAAACTGACCCTGTCACCAGAGGCATCGAGATCACTGT
GAATTATCTGGGAATCCAGTTCGATGTGAAGTTCTGGTCTCAGCACATTTCTTTCATCCTGGTTGGAATA
ATCATTGTCACGTCCATCAGGGGACTGCTGATCACACTTACCAAGTTCTTTTACGCCATCTCCAGCAGTA
AGTCCTCCAATGTCATCGTCCTGCTCTTAGCACAGATAATGGGAATGTACTTTGTGTCCTCTGTACTGCT
GATCCGAATGAGTATGCCCCCAGAATACCGCACCATAATCACAGAGGTCCTTGGAGAGCTTCAGTTCAAC
TTCTATCACCGCTGGTTTGACGTCATCTTCCTGGTCAGTGCCCTCTCCAGCATATTGTTCCTCTATCTGG
CTCACAAGCAGGCGCCAGAGAAGCATATGGCCCCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001139486
ORF Size 1368 bp
Insert Size 1368
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001139486.1, NP_001132958
RefSeq Size 1824
RefSeq ORF 1368
Locus ID 362003
Cytogenetics 2q34
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.