Il1rn (NM_022194) Rat Untagged Clone

CAT#: RN213138

Il1rn (untagged ORF) - Rat interleukin 1 receptor antagonist (Il1rn), (10 ug)


  "NM_022194" in other vectors (3)

Reconstitution Protocol

USD 480.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Il1rn"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Il1rn
Synonyms IL-1ra
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213138 representing NM_022194
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAATCTGCAGGGGACCTTACAGTCACCTAATCTCTCTCCTTCTCATCCTTCTGTTTCGTTCAGAGT
CAGCTGGCCACCCTGCTGGGAAAAGACCCTGCAAGATGCAAGCCTTCAGAATCTGGGATACTAACCAGAA
GACCTTCTACCTGAGGAACAACCAGCTCATTGCTGGGTACTTACAAGGACCAAATACCAAACTAGAAGAA
AAGATAGACATGGTGCCTATTGACTTTCGGAATGTGTTCTTGGGCATCCACGGGGGCAAGCTGTGCCTGT
CTTGTGTCAAGTCTGGAGATGACACCAAGCTCCAGCTGGAGGAGGTTAACATCACTGATCTGAACAAGAA
CAAAGAAGAAGACAAGCGCTTTACCTTCATCCGCTCCGAGACAGGCCCTACCACCAGCTTCGAATCACTT
GCCTGTCCAGGATGGTTCCTCTGCACAACACTAGAGGCTGATCATCCCGTGAGCCTCACCAACACACCAA
AAGAGCCCTGTACAGTCACAAAGTTCTACTTCCAGGAAGACCAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_022194
Insert Size 537 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_022194.2, NP_071530.1
RefSeq Size 1942 bp
RefSeq ORF 537 bp
Locus ID 60582
UniProt ID P25086
Cytogenetics 3p13
Gene Summary binds to IL-1 receptor, blocking the binding of IL-1 alpha and -beta [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.