Cdx2 (NM_023963) Rat Untagged Clone

CAT#: RN209439

Cdx2 (untagged ORF) - Rat caudal type homeo box 2 (Cdx2), (10 ug)

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Cited in 1 publication.

Product images

Specifications

Product Data
Product Name Cdx2 (NM_023963) Rat Untagged Clone
Symbol Cdx2
Vector pCMV6-Entry
Sequence Data
>RN209439 representing NM_023963
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTACGTGAGCTACCTTCTGGACAAGGACGTGAGCATGTACCCTAGCTCCGTGCGCCACTCCGGCGGCC
TCAACCTGGCGCCGCAGAACTTTGTCAGTCCCCCGCAGTACCCGGACTACGGTGGTTACCACGTGGCGGC
CGCCGCTGCTGCGGCGGCGAACTTGGACAGCGCTCAGTCCCCAGGGCCATCCTGGCCCACCGCGTACGGC
GCCCCTCTCCGCGAGGACTGGAATGGCTACGCACCCGGGGGCGCTGCCGCAGCCAACGCGGTAGCCCACG
GCCTCAATGGTGGCTCCCCGGCCGCCGCTATGGGCTACAGCAGCCCCGCCGAATACCACGCACACCATCA
CCCGCATCATCACCCTCACCATCCGGCCGCTGCGCCGTCCTGCGCCTCCGGATTGCTGCAGACGCTCAAC
CCCGGCCCTCCAGGGCCCGCAGCCACCGCCGCCGCAGAACAGCTGTCCCCCAGCGGCCAGCGGCGAAACC
TTTGTGAATGGATGAGGAAGCCAGCTCAGCCGTCCCTAGGAAGCCAAGTGAAAACCAGGACGAAAGACAA
ATACCGGGTGGTGTACACAGACCATCAGCGGCTGGAGCTGGAGAAGGAATTTCACTATAGTCGATACATC
ACCATCAGGAGGAAAGCTGAGTTGGCCGCCACACTCGGGCTCTCGGAGAGGCAGGTTAAAATTTGGTTTC
AGAACCGCAGAGCCAAGGAAAGGAAAATCAACAAAAAGAAGTTGCAACAGCAGCAGCAGCAGCAGCCTCC
CGCACCGCCGCCACCACAGCCTTCCCAGCCTCAGTCCGGTGCATTGCGGAGCGTGCCGGAGCCCTTGAGT
CCTGTGACCTCCTTGCAAGGCTCGGTGCCTGGTTCTGTTCCTGGGGTTCTGGGGCCAGCTGGAGGGGTTT
TAAACTCCACTGTCACCCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_023963
ORF Size 933 bp
Insert Size 933
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_023963.1, NP_076453
RefSeq Size 2072
RefSeq ORF 933
Locus ID 66019
Cytogenetics 12p11
Gene Summary an intestine specific transcription factor [RGD, Feb 2006]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)