Jak1 (NM_053466) Rat Untagged Clone

USD 1,890.00


Availability*
5 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Jak1 (NM_053466) Rat Untagged Clone
Type Rat Untagged Clone
Tag Tag Free
Symbol Jak1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>RN209166 representing NM_053466
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGTATCTAAATATAAAAGAGGACTGCAATGCCATGGCTTTCTGTGCTAAAATGAGGAGCTTCAAGA
AGACGGAGGTGAAGCAGGTGGCCCCTGAGCCAGGAGTGGAAGTGACTTTCTATCTGTTGGACAGGGAGCC
CCTCCGCCTGGGCAGCGGAGAGTACACCGCGGAGGAGCTGTGCATCAGGGCCGCACAGGAATGCAGTATC
TCTCCTCTCTGCCACAACCTCTTCGCCTTGTATGATGAGAGCACCAAGCTCTGGTATGCTCCAAACCACA
TCATCACTGTGGATGACAAAATGTCTCTCCGGCTGCACTACCGCATGAGGTTCTACTTTACCAACTGGCA
TGGAACCAATGACAATGAACAGTCTGTATGGCGACATTCTCCAAAGAAGCAGAAAAATGGCTATGAGAAG
AAAAAGGTTCCAGAAGCAACCCCACTCCTTGATGCCAGTTCACTGGAGTATCTGTTTGCGCAGGGACAGT
ATGATTTGATCAAATGCCTGGCTCCCATTCGGGACCCCAAGACAGAGCAAGATGGACATGATATTGAGAA
TGAGTGCCTGGGCATGGCTGTCCTGGCCATCTCACACTATGCCATGATGAAGAAGATGCAGTTGCCAGAG
CTTCCCAAAGACATCAGCTACAAGCGATATATTCCAGAAACATTGAATAAATCCATCAGACAGAGGAATC
TTCTTACCAGGATGCGAATAAATAATGTTTTCAAGGATTTCTTGAAGGAATTTAACAACAAGACCATCTG
TGACAGCAGTGTGTCTACACACGACCTGAAGGTGAAGTACCTGGCTACCTTGGAAACCTTAACCAAGCAT
TATGGAGCCGAGATATTTGAGACTTCTATGCTCCTGATTTCATCAGAAAATGAGCTGAGTCGGTGCCATT
CCAACGACAGTGGCAATGTTCTCTATGAAGTCATGGTAACAGGAAATCTCGGGATCCAGTGGCGGCAGAA
ACCAAATGTTCTTCCTGTTGAAAAGGAAAAAAATAAACTGAAGCGGAAAAAACTGGACTATAATAAACAC
AAGAAGGAGGATGACAGAAACAAACTCCGGGAAGAGTGGAACAGTTTTTCCTATTTCCCCGAGATTACCC
ACATTGTTATCAAGGAGTCTGTGGTCAGCATTAACAAACAGGACAACAAGAACATGGAACTAAAGCTCTC
TTCTCATGAGGAAGCCTTGTCCTTCGTGTCCCTGGTAGATGGCTACTTCCGGCTCACTGCAGATGCTCAC
CATTACCTCTGTACTGATGTGGCTCCCCCGCTGATTGTCCACAACATACAGAATGGCTGTCACGGTCCAA
TCTGCACAGAATATGCCATCAATAAGCTGCGGCAGGAGGGGAGTGAGGAGGGGATGTACGTGCTGAGGTG
GAGCTGCACCGACTTTGACAACATTCTTATGACTGTCAGCTGCTTCGAAAAGTCCGAGGTATTGGGTAAT
CAGAAGCAGTTCAAGAACTTTCAGATTGAGGTGCAGAAGGGCCGCTACAGCCTGCATGGCTCTGTTGACC
ACTTTCCCAGCCTGAGAGACCTCATGAACCACCTCAAGAAGCAGATCCTGCGCACGGACAATATAAGCTT
TGTGCTGAAACGCTGCTGTCAGCCTAAGCCTCGAGAAATCTCCAACCTACTTGTAGCCACTAAGAAAGCC
CAGGAGTGGCAGCCTGTCTACTCTATGAGCCAGCTGAGTTTCGATCGGATCCTTAAGAAAGATATTATCC
AAGGTGAGCACCTTGGCAGAGGCACAAGAACACATATCTATTCTGGGACCCTGCTGGATTACAAGGACGA
TGAAGGAATTGCTGAAGAAAAGAAGATAAAAGTGATTCTCAAAGTCCTAGACCCTAGCCACCGGGACATT
TCACTGGCCTTCTTTGAGGCAGCCAGCATGATGAGACAGGTTTCCCACAAACACATCGTGTACCTCTACG
GCGTCTGTGTCCGAGATGTGGAAAATATCATGGTGGAAGAGTTTGTGGAGGGGGGGCCATTGGATCTCTT
CATGCACCGGAAAAGTGATGCACTTACTACCCCTTGGAAGTTTAAAGTTGCCAAACAGCTGGCCAGCGCC
CTGAGTTACTTGGAAGATAAAGACCTCGTTCATGGAAATGTGTGCACTAAAAACCTCCTCCTGGCCCGTG
AGGGCATTGACAGTGACATTGGCCCGTTCATCAAGCTTAGTGACCCTGGCATCCCAGTCTCTGTGCTGAC
CAGGCAAGAGTGCATAGAGCGAATTCCCTGGATCGCTCCTGAGTGTGTTGAAGACTCCAAGAACCTGAGT
GTGGCTGCTGACAAGTGGAGCTTTGGAACCACACTCTGGGAAATCTGCTACAATGGCGAGATCCCACTCA
AGGACAAGACCCTCATTGAGAAAGAGAGGTTTTATGAAAGCCGCTGCAGGCCAGTGACACCATCTTGCAA
GGAGCTAGCTGACCTCATGACTCGCTGCATGAACTATGATCCCAACCAGAGACCTTTCTTCCGAGCCATC
ATGAGGGACATTAACAAGCTGGAGGAGCAGAATCCAGACATTGTTTCAGAAAAGCAGCCAATAACAGAGG
TGGATCCCACTCATTTTGAAAAGCGTTTCCTAAAGAGGATTCGTGACTTGGGAGAGGGTCACTTTGGGAA
GGTTGAGCTCTGCAGATATGATCCTGAGGGAGACAACACAGGGGAACAGGTAGCTGTCAAGTCCCTGAAG
CCTGAGAGTGGAGGTAACCACATAGCTGATCTGAAGAAGGAGATAGAGATCTTACGGAACCTCTACCACG
AGAACATTGTGAAGTATAAAGGAATCTGCATGGAAGACGGAGGGAATGGTATCAAGCTCATCATGGAGTT
TCTGCCTTCGGGAAGCCTAAAGGAATATCTGCCAAAGAATAAGAACAAAATCAACCTCAAACAGCAGCTA
AAATATGCCATCCAGATTTGTAAGGGGATGGACTATCTGGGCTCTCGGCAATATGTTCACCGGGACTTAG
CAGCAAGAAATGTCCTTGTTGAGAGTGAACACCAAGTGAAGATCGGAGACTTTGGTTTAACCAAAGCAAT
TGAGACCGATAAGGAGTACTACACAGTCAAGGATGACCGGGACAGCCCAGTGTTTTGGTACGCTCCGGAG
TGTTTAATCCAGTGTAAATTTTATATCGCCTCTGATGTCTGGTCTTTTGGAGTGACACTGCACGAGTTGC
TCACGTACTGTGACTCAGATTTTAGTCCCATGGCCTTGTTCCTGAAAATGATAGGCCCAACTCATGGCCA
GATGACAGTAACACGGCTTGTGAATACTCTGAAAGAAGGAAAGCGCCTGTCCTGTCCACCCAACTGTCCC
GATGAGGTTTATCAGCTTATGAGAAAATGCTGGGAATTCCAACCATCTAATCGGACAACCTTTCAGAACC
TTATTGAAGGATTTGAAGCACTTTTAAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_053466
ORF Size 3462 bp
Insert Size 3462
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_053466.1, NP_445918
RefSeq Size 4291
RefSeq ORF 3462
Locus ID 84598
Cytogenetics 5q33
Gene Summary protein-tyrosine kinases; involved in intracellular signal transduction [RGD, Feb 2006]

Other Versions

Other products for "Jak1"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
BOGO Free lysates
68 Mouse Clones