Glo1 (NM_207594) Rat Untagged Clone

CAT#: RN208083

Glo1 (untagged ORF) - Rat glyoxalase 1 (Glo1), (10 ug)

USD 402


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Glo1 (NM_207594) Rat Untagged Clone
Symbol Glo1
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>RN208083 representing NM_207594
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGAGCCACAGCCAGCGTCCAGTGGTCTTACTGATGAGGCCGCCCTCAGTTGCTGCTCTGACCCGG
ATCCAAGCACCAAGGATTTTCTACTGCAGCAAACGATGCTGAGAATTAAGGACCCTAAGAAGTCCCTGGA
TTTTTATACGAGGGTTCTTGGACTGACGCTTCTCCAGAAGCTTGACTTCCCTTCTATGAAGTTCTCGCTC
TATTTCTTAGCGTACGAGGATAAGAACGATATCCCCAAGGACAAGACGGAGAGGACAGCGTGGGCTTTTT
CCAGAAAGGCTACCCTGGAGCTCACACACAACTGGGGCACTGAAGATGACGAGACGCAGAGTTACCACAA
CGGCAACTCGGACCCTCGGGGATTTGGCCACATTGGGATTGCTGTTCCTGATGTCTACGAGGCCTGTAAG
AGATTTGAAGAACTAGGTGTCAAGTTTGTGAAGAAGCCTGATGATGGGAAAATGAAAGGTCTGGCGTTCG
TTCAAGATCCTGATGGCTACTGGATTGAAATTCTGAATCCTAACAAAATGGCAACAATTATTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_207594
ORF Size 555 bp
Insert Size 555
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_207594.2, NP_997477
RefSeq Size 1079
RefSeq ORF 555
Locus ID 294320
Cytogenetics 20p12
Gene Summary predicted to have lactoylglutathione lyase activity [RGD, Feb 2006]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations