Mgmt (NM_012861) Rat Untagged Clone

CAT#: RN207261

Reviews ()
Write a review

Mgmt (untagged ORF) - Rat O-6-methylguanine-DNA methyltransferase (Mgmt), (10 ug)



Reconstitution Protocol

USD 480.00

4 Weeks*

Size
    • 10 ug

Product images

Other products for "Mgmt"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Mgmt
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN207261 representing NM_012861
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGAGATCTGCAAAATGAAATACACGGTGTTGGACAGCCCTTTGGGGAAGATAGAGCTGTCCGGCT
GTGAGCGAGGCCTGCATGGGATACGATTTCTCAGTGGGAAGACCCCAAACACTGACCCCACAGAGGCTCC
AGCCTGTCCTGAGGTGCTCGGTGGGCCAGAGGGAGTGCCAGAGCCCCTGGTGCAGTGCACAGCCTGGCTG
GAAGCCTATTTCCACGAACCTGCAGCCACAGAGGGGCTTCCCTTGCCTGCTCTCCATCACCCTGTGTTCC
AGCAAGATTCATTCACCAGACAGGTGTTATGGAAGCTGCTGAAGGTTGTGAAATTCGGAGAAATGGTTTC
TTACCAGCAATTAGCAGCCCTGGCAGGCAACCCCAAAGCGGCTCGTGCAGTAGGAGGAGCGATGAGGAGC
AATCCAGTCCCCATCCTCATCCCCTGCCACAGGGTGATTCGCAGTGACGGTGCCATTGGCAATTACTCTG
GAGGAGGACAGACTGTGAAAGAGTGGCTTCTGGCCCATGAGGGCATCCCAACTGGACAGCCGGCCTCCAA
AGGCTTGGGTCTGATTGGGAGCTGGCTCAAGCCATCCTTCGAGTCTTCCAGCCCAAAGCCGTCTGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_012861
Insert Size 630 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_012861.1, NP_036993.1
RefSeq Size 812 bp
RefSeq ORF 630 bp
Locus ID 25332
UniProt ID P24528
Cytogenetics 1q41
Gene Summary enzyme involved in DNA repair of O(6)-alkylguanine which is the major mutagenic and carcinogenic lesion in DNA [RGD, Feb 2006]
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.