Cd200 (NM_031518) Rat Untagged Clone

CAT#: RN206783

Cd200 (untagged ORF) - Rat Cd200 molecule (Cd200), (10 ug)

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Cited in 1 publication.

Product images

Specifications

Product Data
Product Name Cd200 (NM_031518) Rat Untagged Clone
Symbol Cd200
Synonyms Cspmo2; Mox2; MRCOX2
Vector pCMV6-Entry
Sequence Data
>RN206783 representing NM_031518
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCAGTCCGGTATTCAGGAGACCTTTCTGCCATCTGTCCACCTACAGCCTGCTCTGGGCCATAGCAG
CAGTAGCGCTGAGCACAGCTCAAGTGGAAGTGGTGACCCAGGATGAAAGAAAGCTGCTGCACACAACTGC
ATCCTTACGCTGTTCTCTAAAAACAACCCAGGAACCCTTGATTGTGACATGGCAGAAAAAGAAAGCCGTA
GGCCCAGAAAACATGGTCACTTACAGCAAAGCCCATGGGGTTGTCATTCAGCCCACCTACAAAGACAGGA
TAAACATCACTGAGCTGGGACTCTTGAACACAAGCATCACCTTCTGGAACACAACCCTGGATGATGAGGG
TTGCTACATGTGTCTCTTCAACATGTTTGGATCTGGGAAGGTCTCTGGGACAGCTTGCCTTACTCTCTAT
GTACAGCCCATAGTACACCTTCACTACAACTATTTTGAAGACCACCTAAACATCACGTGCTCTGCAACTG
CCCGCCCAGCCCCTGCCATCTCCTGGAAGGGCACTGGGTCAGGAATTGAGAATAGTACTGAGAGTCACTC
CCATTCAAATGGGACTACATCTGTCACCAGCATCCTCCGGGTCAAAGACCCCAAAACTCAGGTTGGAAAG
GAAGTGATCTGCCAGGTTTTATACTTGGGGAATGTGATTGACTACAAGCAGAGTCTGGACAAAGGATTTT
GGTTTTCAGTCCCACTGCTGCTGAGCATTGTTTCTCTGGTAATTCTTCTGGTCTTGATCTCCATCTTATT
ATACTGGAAACGGCACCGAAATCAGGAGCGGGGTGAGTCATCACAGGGGATGCAAAGAATGAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_031518
ORF Size 837 bp
Insert Size 837
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_031518.1, NP_113706
RefSeq Size 2263
RefSeq ORF 837
Locus ID 24560
Cytogenetics 11q21
Gene Summary glycoprotein; involved in neuronal cell-to-cell interaction [RGD, Feb 2006].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)