Gpr35 (NM_001037359) Rat Untagged Clone

CAT#: RN205323

Gpr35 (untagged ORF) - Rat G protein-coupled receptor 35 (Gpr35), (10 ug)

USD 402


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gpr35 (NM_001037359) Rat Untagged Clone
Symbol Gpr35
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>RN205323 representing NM_001037359
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACAATACAAATTGTAGCATCCTCCCGTGGCCTGCTGCAGTCAACCACATCTTCACCATCTACTTGG
TCTTGCTGCTGGTGCTGGGCCTGCTGCTCAATGGCCTGGCACTCTGGGTATTCTGCTATCGCATGCACCA
GTGGACGGAGACCCGAGTCTATATGACCAACCTGGCTGTGGCTGACGTCTGCCTGCTCTGCTCCTTGCCA
TTCGTGCTGTACTCCCTGAAATACAGTACTTCGGACACACCCATCTGCCAGCTCTCACAGGGCATCTACC
TGGTCAACAGGTACATGAGCATAAGCTTGGTCACCGCCATTGCTGTGGACCGCTATGTGGCAGTGCGGCA
TCCCCTGCGTGCCCGTGAGCTGCGGTCCCCACGGCAGGCTGGAGCAGTGTGTGTGGCCCTCTGGGTGATA
GTGGTCACCTCCCTGGTACTGCGCTGGCGCCTGGGGATACAGGAGGGTGGCTTCTGCTTCAGCAGCCAAA
ATCGGTACAACTTCAGCACCACTGCCTTCTCGCTGCTGGGATTCTACCTGCCGCTGGCCATAGTGGTCTT
CTGCTCTTTGCAGGTTGTGACTGCGTTGGCCCGAAGGCCAGCCACTGACGTGGAGCAGGTGGAGGCCACT
CAGAAGGCCACCCGCATGGTCTGGGCCAACTTGGCCGTGTTTATCATCTGCTTCCTGCCCCTGCATTTGA
TCCTGACAGTGCAGGTCTCCCTGAACCTCCACACCTGCGCTGCCCGAAACATCTTCAGCCGTGCCCTGAC
AATCACAGCCAAGCTCTCAGACATCAACTGCTGCCTGGATGCCATCTGTTACTACTACATGGCCAAAGAG
TTCCAGGATGCGTCCTTGCGGGCCACAGCCTCTAGCACACCCCACAAGAGCCAAGATACTCAGAGCCTGA
GCCTCACCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001037359
ORF Size 921 bp
Insert Size 921
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001037359.1, NP_001032436
RefSeq Size 921
RefSeq ORF 921
Locus ID 367315
Cytogenetics 9q36
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations