Aatf (NM_053720) Rat Untagged Clone

CAT#: RN203248

Aatf (untagged ORF) - Rat apoptosis antagonizing transcription factor (Aatf), (10 ug)

USD 670


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Aatf (NM_053720) Rat Untagged Clone
Symbol Aatf
Synonyms Ded; Ded
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>RN203248 representing NM_053720
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGAGCTGCAGCCCCTGGCTCTGCAGCTGGAACAGTTGTTGAATCCAAGACCGCGTGAGGCGGATC
CTGAGGCGGACCCGGAGGAGGCCACTAGAGCCAGAGTGATTGACAGGTTTGATGAAGGGGAAGAGGAAGA
AGATGATCTGCCAGTGAGTAGTATTAGAAAGTTGGCACCGGTCTCCCTCTTGGACACCGACAAAAGGTAT
TCTGGCAAGACCACTTCTCGGAAAGCTTGGAAAGAAGACCATTGGGACCAGACTCTGCCAAGTTCATCGG
ACAATGAAATACCTGATGAAGGAGGCTCTGAAGCTGGGGATTCAGAGGGCCTGGAGGAGCTCTCAGAAGA
TGTTGAGGAAGACTTGGAAGACAATGAAATACCTGATGAAGGAGGCTCTGAAGATGGGGATTCAGAGGGC
CTGGAGGAGGAGATCTCAGAAGATGTTGAGGAAGACTTAGAAGGTGAGGATGAGGAAGACAGAGAAGAGG
ACAGGAACAGTGAAGATGACGGCGTGGTGATGGCCTTCTCCGGTGTTAAAGTTTCTGAGGAAGTGGAAAA
AGGAAGAGCTGTGAAGAACCAGATAGCGTTGTGGGACCAGCTCTTGGAAGGAAGGATCAAACTACAAAAA
GCTCTCTTGACTACCAATCAATTGCCTCAACCAGATGTTTTCCCTGTCTTCAAGGACAAAGGTGGCCCAG
AATTTGCCAGTGCTCTGAAAAATAGTCACAAAGCACTTAAAGCATTGTTAAGATCATTGGTGGATCTTCA
GGAAGAGTTGCTTTTCCAGTACCCAGATACAAGATATTTAGTAAAAGGGACGAAACCCAATGCAGAGAGT
GAGGAGATTTCCAGTGAAGATGATGAGCTAGTGGGAGAGAAGAAGAAACAAAGAAAGGCCCCACCAAAGA
GGAAGCTAGAGATGGAGGACTATCCCAGCTTCATGGCAAAGCGCTCTGCTGACTTTACCGTCTACAGGAA
CCGCACACTACAAAAATGGCATGATAAAACCAAGCTTGCTTCTGGAAAACTGGGCAAGGGTTTCGGTGCC
TTTGAACGCTCCATCTTGACTCAGATTGATCATATTCTGATGGACAAAGAAAGATTACTTCGAAGGACGC
AGACCAAGCGCTCTGCCTACCGAGTTCTTGGCAAACCTGAGCCAGTCCCTGAGCCTGTTGCAGAGACTTT
GCCAGGAGAACCGGAGAGCCTTCCTCAGGTCCCTGCCAATGCTCACCTGAAGGACTTGGACGAGGAGATA
TTTGATGATGATGACTTCTACCACCAGCTCCTTCGAGAACTCATAGAGCGGAAGACCAGCTCTTTGGATC
CAAATGATCAGGTGGCCATGGGAAGGCAGTGGCTTGCAATCCAGAAACTACGAAGCAAAATCCGCAAGAA
GGTAGATAGAAAAGCCAGCAAAGGAAGAAAACTTCGGTTCCATGTGCTTAGCAAGCTCCTGAGTTTCATG
GCGCCTATTGACCACACTGCAATGAATGATGAGGCCAGGACCGAGTTGTATCGATCTCTTTTCGGCCAGC
TCAACCGTCTGGACGCAGACCATGGGCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_053720
ORF Size 1572 bp
Insert Size 1572
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_053720.1, NP_446172
RefSeq Size 1805
RefSeq ORF 1572
Locus ID 114512
Cytogenetics 10q26
Gene Summary an apoptosis antagonizing nuclear phosphoprotein transcription factor [RGD, Feb 2006].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.