Abcg1 (NM_053502) Rat Untagged Clone

CAT#: RN202746

Abcg1 (untagged ORF) - Rat ATP-binding cassette, sub-family G (WHITE), member 1 (Abcg1), (10 ug)

USD 845


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Abcg1 (NM_053502) Rat Untagged Clone
Symbol Abcg1
Synonyms Abc8; Abc8
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>RN202746 representing NM_053502
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCTGTCTGATGGCCGCTTTCTCGGTCGGCACCGCCATGAATGCCAGCAACTACTCGGCCGCAATGA
CGGAACCCAAGTCCGTGTGCGTGTCGGTGGACGAGGTCGTGTCCAGCAACGTGGATGAGCTTGAGACAGA
TCTGCTTAATGGGCACCTGAAGAAGGTGGACAACAACTTCACGGAGGCCCAGCGCTTTTCCTCCCTGCCG
CGGAGGGCGGCCGTGAATATCGAATTCAAGGACCTTTCTTACTCCGTACCCGAGGGACCCTGGTGGAGGA
AGAAAGGATACAAGACCCTTTTGAAAGGGATCTCTGGGAAGTTCAACAGTGGAGAGCTGGTGGCCATCAT
GGGTCCTTCTGGAGCTGGGAAGTCCACACTCATGAATATTCTGGCGGGATACAGGGAGACGGGCATGAAG
GGGGCAGTCCTTATCAATGGTATGCCCCGCGACCTGCGCTGCTTCCGGAAGGTCTCGTGCTACATCATGC
AGGATGACATGCTGCTGCCTCACCTCACTGTCCAGGAGGCCATGATGGTGTCCGCGCATCTGAAGCTGCA
AGAGAGGGATGAAGGCAGACGGGAGATGGTCAAGGAGATCCTGACAGCACTGGGCTTGCTGCCCTGTGCC
AACACACGCACAGGGAGCCTCTCGGGTGGCCAGCGGAAGCGCCTGGCCATTGCACTAGAACTGGTCAACA
ACCCTCCTGTTATGTTCTTTGATGAGCCCACCAGTGGCCTGGACAGTGCCTCTTGCTTCCAAGTGGTGTC
CCTGATGAAAGGGCTGGCCCAGGGCGGCCGCTCCATCGTCTGCACCATCCACCAACCCAGTGCCAAGCTC
TTCGAGCTCTTTGACCAGCTTTATGTCCTAAGTCAAGGACAATGTGTCTACCGGGGAAAGGTCTCGAATC
TCGTGCCGTACCTGAGGGATCTGGGTCTGAACTGCCCTACCTACCACAACCCTGCAGACTTTGTCATGGA
AGTGGCATCAGGGGAGTACGGTGATCAGAACAGCCGCCTGGTGAGGGCCGTTCGGGAGGGCATGTGTGAC
TCTGACTATAAGAGAGAACTCGGGGGCGACGGAGACGTGAACCCGTTCCTCTGGCACCGGCCTGCTGAAG
AGGACTCGGCCTCCATGGAAGGTTGCCACAGCTTCTCGGCCAGCTGCCTCACCCAGTTCTGCATCCTCTT
CAAGAGGACCTTCCTTAGCATCATGCGGGACTCGGTACTGACACACCTGCGAATCACCTCACACATCGGG
ATCGGTCTCCTCATTGGCCTCCTGTACCTTGGGATTGGGAACGAAGCCAAGAAGGTCCTGAGCAACTCCG
GCTTCCTGTTCTTCTCCATGCTGTTCCTCATGTTCGCCGCCCTCATGCCCACCGTTCTGACCTTTCCCCT
CGAGATGAGTGTCTTCCTCCGAGAGCACCTGAACTACTGGTACAGTCTGAAGGCCTACTACCTGGCCAAG
ACCATGGCTGATGTCCCCTTTCAGATCATGTTCCCCGTGGCCTACTGCAGCATCGTGTACTGGATGACAT
CACAGCCGTCGGACGCTGTGCGTTTTGTGCTGTTCGCTGCACTGGGCACCATGACCTCGTTGGTGGCCCA
GTCCTTAGGCCTACTCATTGGAGCTGCGTCCACATCCCTGCAGGTTGCGACGTTTGTGGGTCCCGTGACA
GCCATCCCTGTCTTGCTCTTCTCCGGGTTCTTTGTCAGCTTTGACACCATCCCAACCTACCTGCAGTGGA
TGTCCTACATCTCCTACGTCAGATACGGCTTCGAGGGGGTCATCCTGTCCATCTATGGCTTGGACCGAGA
GGACCTGCACTGCGACATCGCGGAGACATGCCACTTCCAGAAGTCAGAGGCCATCCTGCGGGAGCTAGAT
GTGGAGAACGCGAAGCTATACCTGGATTTCATCGTCCTGGGCATCTTCTTCATCTCCCTGCGGCTCATCG
CCTATTTTGTCCTGAGATACAAAATCCGGGCTGAGAGGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_053502
ORF Size 2001 bp
Insert Size 2001
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_053502.1, NP_445954
RefSeq Size 3527
RefSeq ORF 2001
Locus ID 85264
Cytogenetics 20p12
Gene Summary ATP-binding cassette (ABC) half-transporter that facilitates the efflux of excess cholesterol from macrophages and may play an important role in cholesterol homeostasis [RGD, Feb 2006]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.