Actc1 (NM_019183) Rat Untagged Clone

CAT#: RN202192

Reviews ()
Write a review

Actc1 (untagged ORF) - Rat actin, alpha, cardiac muscle 1 (Actc1), (10 ug)



  "NM_019183" in other vectors (3)

USD 430.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Actc1 (NM_019183) Rat Untagged Clone
Type Rat Untagged Clone
Tag Tag Free
Symbol Actc1
Synonyms MGC156490
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>RN202192 representing NM_019183
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGTGACGACGAGGAGACCACAGCTTTGGTGTGCGACAATGGCTCCGGACTGGTGAAGGCTGGCTTTG
CGGGTGATGATGCTCCCAGAGCTGTCTTCCCATCCATCGTGGGTCGCCCACGCCACCAGGGTGTCATGGT
AGGTATGGGGCAGAAAGACTCCTATGTAGGTGACGAGGCTCAGAGCAAGCGAGGCATCCTGACTCTGAAG
TACCCCATAGAGCACGGCATTATCACCAACTGGGACGACATGGAGAAGATCTGGCACCACACCTTCTACA
ATGAGCTCCGTGTGGCCCCTGAGGAGCACCCGACCCTGCTCACTGAGGCCCCACTGAACCCCAAGGCCAA
CCGTGAGAAGATGACACAGATCATGTTTGAGACCTTCAATGTGCCTGCCATGTATGTGGCCATCCAGGCG
GTGCTGTCCCTGTACGCTTCTGGGAGAACCACAGGCATTGTTCTGGATTCTGGCGACGGTGTGACTCATA
ACGTCCCCATCTATGAGGGTTATGCCTTACCCCATGCCATCATGCGTCTGGATCTAGCTGGTCGGGACCT
CACTGACTACCTTATGAAGATCCTCACTGAGCGCGGGTACTCCTTTGTCACCACCGCTGAACGTGAAATT
GTCCGAGACATCAAAGAAAAACTGTGTTATGTCGCCCTGGATTTTGAGAATGAGATGGCCACCGCTGCAT
CTTCCTCCTCTCTGGAGAAGAGCTACGAACTTCCCGATGGCCAGGTCATCACCATTGGCAACGAGCGTTT
CCGCTGTCCTGAGACTCTCTTCCAGCCCTCTTTCATTGGTATGGAGTCTGCCGGCATTCACGAAACTACT
TATAACAGCATCATGAAGTGTGACATCGATATCCGCAAAGACCTGTACGCCAACAATGTCCTGTCTGGAG
GCACCACCATGTACCCTGGGATTGCTGATCGTATGCAAAAGGAAATAACTGCACTGGCTCCCAGCACCAT
GAAGATTAAGATTATTGCTCCCCCTGAGCGTAAATACTCTGTCTGGATTGGGGGCTCCATCCTGGCCTCT
CTGTCTACCTTCCAACAAATGTGGATCAGCAAGCAAGAGTACGATGAGGCCGGGCCCTCCATTGTCCACC
GCAAGTGCTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_019183
Insert Size 1134 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_019183.1, NP_062056.1
RefSeq Size 1489 bp
RefSeq ORF 1134 bp
Locus ID 29275
Cytogenetics 3q35
Gene Summary may act as a structural component of the cytoskeleton; may play a role in muscle function [RGD, Feb 2006]

Other Versions

Other products for "Actc1"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools