Tp53 (NM_030989) Rat Untagged Clone

CAT#: RN201296

Tp53 (untagged ORF) - Rat tumor protein p53 (Tp53), (10 ug)


  "NM_030989" in other vectors (3)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit Anti-p53 (Ser392) Antibody (Phospho-Specific)
    • 100 ul

USD 545.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Tp53"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Tp53
Synonyms p53; Trp53
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN201296 representing NM_030989
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGATTCACAGTCGGATATGAGCATCGAGCTCCCTCTGAGTCAGGAGACATTTTCATGCTTATGGA
AACTTCTTCCTCCAGATGATATTCTGCCCACCACAGCGACAGGGTCACCTAATTCCATGGAAGATCTGTT
CCTGCCCCAGGATGTTGCAGAGTTGTTAGAAGGCCCAGAGGAAGCCCTCCAAGTGTCAGCTCCTGCAGCA
CAGGAACCTGGAACTGAGGCCCCTGCACCCGTGGCCCCTGCTTCAGCTACACCGTGGCCTCTGTCATCTT
CCGTCCCTTCTCAAAAAACTTACCAAGGCAACTATGGCTTCCACCTGGGCTTCCTGCAGTCAGGGACAGC
CAAGTCTGTTATGTGCACGTACTCAATTTCCCTCAATAAGCTGTTCTGCCAGCTGGCGAAGACATGCCCT
GTGCAGTTGTGGGTCACCTCCACACCTCCACCTGGTACCCGTGTCCGTGCCATGGCCATCTACAAGAAGT
CACAACACATGACTGAGGTCGTGAGACGCTGCCCCCACCATGAGCGTTGCTCTGATGGTGACGGCCTGGC
TCCTCCCCAACATCTTATCCGGGTGGAAGGAAATCCGTATGCTGAGTATCTGGACGACAGGCAGACTTTT
CGGCACAGCGTGGTGGTACCGTATGAGCCACCTGAGGTCGGCTCCGACTATACCACTATCCACTACAAGT
ACATGTGCAACAGCTCCTGCATGGGGGGCATGAACCGCCGGCCCATCCTTACCATCATCACGCTGGAAGA
CTCCAGTGGGAATCTTCTGGGACGGGACAGCTTTGAGGTTCGTGTTTGTGCCTGTCCTGGGAGAGACCGT
CGGACAGAGGAAGAAAATTTCCGCAAAAAAGAAGAGCATTGCCCGGAGCTGCCCCCAGGGAGTGCAAAGA
GAGCACTGCCCACCAGCACAAGCTCCTCTCCCCAGCAAAAGAAAAAACCACTCGATGGAGAATATTTCAC
CCTTAAGATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAATTAAAGGAT
GCCCGTGCTGCCGAGGAGTCAGGAGACAGCAGGGCTCACTCCAGCTACCCGAAGACCAAGAAGGGCCAGT
CTACGTCCCGCCATAAAAAACCAATGATCAAGAAAGTGGGGCCTGACTCAGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_030989
Insert Size 1176 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_030989.3, NP_112251.2
RefSeq Size 1792 bp
RefSeq ORF 1176 bp
Locus ID 24842
UniProt ID P10361
Cytogenetics 10q24
Gene Summary This gene encodes tumor protein p53, which responds to diverse cellular stresses to regulate target genes that induce cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. p53 protein is expressed at low level in normal cells and at a high level in a variety of transformed cell lines, where it is believed to contribute to transformation and malignancy. p53 is a DNA-binding protein containing transcription activation, DNA-binding, and oligomerization domains. It is postulated to bind to a p53-binding site and activate expression of downstream genes that inhibit growth and/or invasion, and thus function as a tumor suppressor. Alternatively spliced transcript variants have been found for this gene, but the biological validity of the variants has not been determined. p53 pseudogenes have been found on chromosomes 9 and 18. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.