Akt1 (NM_033230) Rat Untagged Clone

CAT#: RN201042

Akt1 (untagged ORF) - Rat v-akt murine thymoma viral oncogene homolog 1 (Akt1), (10 ug)

USD 608.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Akt1 (NM_033230) Rat Untagged Clone
Symbol Akt1
Synonyms Akt; Akt
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>RN201042 representing NM_033230
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACGACGTAGCCATTGTGAAGGAGGGCTGGCTGCACAAACGAGGGGAATATATTAAAACCTGGCGGC
CACGCTACTTCCTCCTCAAGAATGATGGCACCTTTATTGGCTACAAGGAACGGCCTCAGGATGTGGAGCA
GCGCGAGTCCCCACTCAACAACTTCTCAGTGGCACAATGTCAGCTGATGAAGACAGAGCGGCCGAGGCCC
AACACCTTCATCATCCGCTGCCTGCAGTGGACCACGGTCATTGAGCGCACCTTCCATGTGGAAACGCCTG
AGGAGCGGGAAGAGTGGACCACCGCCATTCAGACTGTGGCTGATGGACTCAAACGGCAGGAGGAGGAGAC
GATGGACTTCCGGTCAGGTTCACCCAGTGACAACTCAGGTGCTGAGGAGATGGAGGTGGCCCTGGCCAAG
CCCAAGCACCGTGTGACCATGAACGAGTTTGAGTACCTGAAGCTACTGGGCAAGGGCACCTTTGGGAAGG
TGATCCTGGTGAAGGAGAAGGCCACAGGTCGCTACTATGCCATGAAGATCCTCAAGAAGGAGGTCATCGT
TGCCAAGGATGAGGTTGCCCACACGCTTACTGAGAACCGTGTCCTGCAGAACTCTAGGCATCCCTTCCTT
ACAGCCCTCAAGTACTCATTCCAGACCCACGACCGCCTCTGCTTTGTCATGGAGTACGCCAATGGAGGCG
AGCTCTTCTTCCACCTGTCTCGTGAGCGCGTGTTTTCAGAGGACCGGGCCCGCTTCTACGGTGCGGAGAT
TGTGTCCGCCCTGGACTACTTGCACTCCGAGAAGAACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTC
ATGCTGGACAAGGACGGGCACATCAAGATAACGGACTTCGGGCTGTGCAAGGAGGGTATCAAGGACGGTG
CCACCATGAAGACGTTCTGCGGGACACCCGAGTACCTGGCCCCTGAGGTGCTGGAGGACAACGACTATGG
CCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTACGAGATGATGTGCGGCCGCCTGCCCTTCTAC
AACCAGGACCATGAGAAGCTGTTCGAGCTCATCCTAATGGAGGAGATCCGCTTCCCACGCACACTCGGGC
CGGAGGCCAAGTCCCTGCTCTCGGGGCTGCTCAAGAAGGACCCTACACAGAGGCTCGGTGGGGGCTCCGA
GGACGCCAAGGAGATCATGCAGCACCGCTTCTTTGCCAACATCGTGTGGCAAGATGTGTATGAGAAGAAG
CTGAGCCCACCTTTCAAGCCCCAGGTCACCTCTGAGACCGACACCAGGTATTTTGATGAGGAGTTCACAG
CTCAGATGATCACCATCACACCGCCTGATCAAGATGACAGCATGGAGTGTGTGGACAGTGAACGGAGGCC
GCACTTTCCCCAGTTCTCCTACTCAGCCAGTGGCACAGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_033230
ORF Size 1443 bp
Insert Size 1443
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_033230.1, NP_150233
RefSeq Size 1613
Locus ID 24185
Cytogenetics 6q32
Gene Summary inhibits JUN kinase activation and mediates inhibition of apoptosis [RGD, Feb 2006]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.