Igf1 (NM_001082477) Rat Untagged Clone

CAT#: RN200510

Igf1 (untagged ORF) - Rat insulin-like growth factor 1 (Igf1), transcript variant 1, (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Igf1
• Synonyms: IGF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN200510 representing NM_001082477
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGCGCACCTCCAATAAAGATACACATCATGTCGTCTTCACATCTCTTCTACCTGGCACTCTGCTTGC
  TCACCTTTACCAGCTCGGCCACAGCCGGACCAGAGACCCTTTGCGGGGCTGAGCTGGTGGACGCTCTTCA
  GTTCGTGTGTGGACCAAGGGGCTTTTACTTCAACAAGCCCACAGGCTATGGCTCCAGCATTCGGAGGGCA
  CCACAGACGGGCATTGTGGATGAGTGTTGCTTCCGGAGCTGTGATCTGAGGAGGCTGGAGATGTACTGTG
  CTCCGCTGAAGCCTACAAAGTCAGCTCGTTCCATCCGGGCCCAGCGCCACACTGACATGCCCAAGACTCA
  GAAGTCCCAGCCCCTATCGACACACAAGAAAAGGAAGCTGCAAAGGAGAAGGAAAGGAAGTACACTTGAA
  GAACACAAGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001082477
• Insert Size: 432 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001082477.2, NP_001075946.2
• RefSeq Size: 1582 bp
• RefSeq ORF: 432 bp
• Locus ID: 24482
• UniProt ID: P08025
• Cytogenetics: 7q13
• Gene Summary: growth factor; plays a major role in mammalian growth [RGD, Feb 2006]
  Transcript Variant: This variant (1) differs in the 5' UTR and 5' coding region, compared to variant 3. These differences cause translation initiation from a distinct start codon and result in an isoform (a) with a novel C-terminus, compared to isoform c. This isoform is also known as IIC.