Gcgr (NM_172092) Rat Untagged Clone

CAT#: RN200458

Gcgr (untagged ORF) - Rat glucagon receptor (Gcgr), transcript variant 1, (10 ug)

USD 618.00


Availability*
In Stock

Size
    • 10 ug

Cited in 1 publication.

Product images

Specifications

Product Data
Product Name Gcgr (NM_172092) Rat Untagged Clone
Symbol Gcgr
Synonyms MGC93090
Vector pCMV6-Entry
Sequence Data
>RN200458 representing NM_172092
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTCCTCACCCAGCTCCACTGTCCCTACCTGCTGCTGCTGCTGGTGGTGCTGTCATGTCTGCCAAAGG
CACCCTCTGCCCAGGTAATGGACTTTTTGTTTGAGAAGTGGAAGCTCTATAGTGACCAGTGCCACCACAA
CCTAAGCCTGCTGCCCCCACCTACTGAGCTGGTCTGCAACAGAACTTTCGACAAGTACTCCTGCTGGCCT
GACACCCCTCCCAACACCACTGCCAACATTTCCTGCCCCTGGTACCTACCTTGGTACCACAAAGTGCAGC
ACCGCCTAGTGTTCAAGAGGTGTGGGCCTGATGGGCAGTGGGTTCGAGGGCCACGGGGGCAGTCATGGCG
CGACGCCTCCCAATGTCAGATGGATGATGACGAGATCGAGGTCCAGAAGGGGGTAGCCAAGATGTATAGC
AGCTACCAGGTGATGTACACTGTGGGCTACAGTCTGTCCCTGGGGGCCTTGCTCCTGGCGCTGGTCATCC
TGCTGGGCCTCAGGAAGCTGCACTGCACCCGGAACTACATCCACGGGAACCTGTTCGCGTCCTTCGTGCT
CAAGGCTGGCTCTGTGCTGGTCATTGATTGGCTGCTCAAGACACGCTATAGCCAGAAGATTGGAGATGAC
CTCAGTGTGAGCGTCTGGCTCAGTGATGGGGCGGTGGCTGGCTGCAGAGTGGCCACAGTGATCATGCAGT
ACGGCATCATAGCCAACTACTGCTGGTTGCTGGTGGAGGGTGTGTACCTGTACAGCCTGCTGAGCATCAC
CACCTTCTCGGAGAAGAGCTTCTTCTCCCTCTATCTGTGCATCGGCTGGGGATCTCCCCTGCTGTTTGTC
ATCCCCTGGGTGGTGGTCAAGTGTCTGTTTGAGAATGTCCAGTGCTGGACCAGCAATGACAATATGGGAT
TCTGGTGGATCCTGCGTATCCCTGTACTCCTGGCCATACTGATCAATTTTTTCATCTTTGTCCGCATCAT
TCATCTTCTTGTGGCCAAGCTGCGTGCCCATCAGATGCACTATGCTGATTACAAGTTCCGGCTAGCCAGG
TCCACGCTGACCCTCATTCCTCTGCTGGGAGTCCACGAAGTGGTCTTTGCCTTTGTGACTGATGAGCATG
CCCAGGGCACCCTGCGCTCCACCAAGCTCTTTTTTGACCTGTTCTTCAGCTCCTTTCAGGGTCTGCTGGT
GGCTGTTCTCTACTGTTTCCTCAACAAGGAGGTGCAGGCAGAGCTACTGCGGCGTTGGAGGCGATGGCAA
GAAGGCAAAGCTCTTCAGGAGGAAAGGATGGCCAGCAGCCATGGCAGCCACATGGCCCCAGCAGGGACTT
GTCATGGTGATCCCTGTGAGAAACTTCAGCTTATGAGTGCAGGCAGCAGCAGTGGGACTGGCTGTGAGCC
CTCTGCGAAGACCTCATTGGCCAGTAGTCTCCCAAGGCTGGCTGACAGCCCCACCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_172092
ORF Size 1458 bp
Insert Size 1458
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_172092.1, NP_742089
RefSeq Size 1901
RefSeq ORF 1458
Locus ID 24953
Cytogenetics 10q32.3
Gene Summary G-protein coupled receptor that binds glucagon and activates adenylate cyclase [RGD, Feb 2006]. Transcript Variant: This variant (3) lacks an internal exon compared to variant 1. It is represented as non-coding because the use of the 5'-most translational start codon, as used in variant 1, renders this transcript a candidate for nonsense-mediated mRNA decay (NMD). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications.
Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)