Kcnip2 (NM_020095) Rat Untagged Clone

CAT#: RN200344

Reviews ()
Write a review

Kcnip2 (untagged ORF) - Rat Kv channel-interacting protein 2 (Kcnip2), transcript variant b, (10 ug)

  View "NM_020095" in other vectors (5)

USD 420.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Kcnip2 (NM_020095) Rat Untagged Clone
Type Rat Untagged Clone
Tag Tag Free
Symbol Kcnip2
Synonyms Kchip2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>RN200344 representing NM_020095
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGGGGCCAAGGCAGAAAGGAGAGTTTGTCCGAATCCCGAGATCTGGACGGCTCCTATGACCAGCTTA
CGGGCCACCCTCCAGGGCCCAGTAAAAAAGCCCTGAAGCAGCGTTTCCTCAAGCTGCTGCCGTGCTGCGG
GCCCCAAGCCCTGCCCTCAGTCAGTGAAAACAGCGTAGAGGATGAGTTTGAATTATCCACGGTGTGTCAC
CGACCTGAGGGCCTGGAACAACTCCAGGAACAGACCAAGTTCACACGCAGAGAGCTGCAGGTCCTGTACC
GAGGCTTCAAGAACGAATGCCCCAGTGGGATTGTCAACGAGGAGAACTTCAAGCAGATTTATTCTCAGTT
CTTTCCCCAAGGAGACTCCAGCAACTATGCTACTTTTCTCTTCAATGCCTTTGACACCAACCACGATGGC
TCTGTCAGTTTTGAGGACTTTGTGGCTGGTTTGTCGGTGATTCTTCGGGGGACCATAGATGATAGACTGA
GCTGGGCTTTCAACTTATATGACCTCAACAAGGACGGCTGTATCACAAAGGAGGAAATGCTTGACATTAT
GAAGTCCATCTATGACATGATGGGCAAGTACACATACCCTGCCCTCCGGGAGGAGGCCCCAAGAGAACAC
GTGGAGAGCTTCTTCCAGAAGATGGACAGGAACAAGGACGGCGTGGTGACCATCGAGGAATTCATCGAGT
CTTGTCAACAGGACGAGAACATCATGAGGTCCATGCAGCTCTTTGATAATGTCATCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_020095
ORF Size 759 bp
Insert Size 759
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_020095.2, NP_064480.2
RefSeq Size 2316
RefSeq ORF 759
Locus ID 56817
Cytogenetics 1q54
Gene Summary Ca(2+)-binding protein that acts as an auxiliary subunit for voltage-gated K(+) channels [RGD, Feb 2006]
Transcript Variant: This variant (b) lacks an exon in the 5' coding region compared to variant a. The resulting protein (isoform b) is shorter but has the same N- and C-termini compared to isoform a.

Other Versions

Other products for "Kcnip2"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones