Calcr (NM_053816) Rat Untagged Clone

CAT#: RN200228

Calcr (untagged ORF) - Rat calcitonin receptor (Calcr), transcript variant 1, (10 ug)

USD 680.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Calcr (NM_053816) Rat Untagged Clone
Symbol Calcr
Vector pCMV6-Entry
Sequence Data
>RN200228 representing NM_053816
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACTCCACGGAGATCCAGAATGAAAAGGCGGAACCTCCGAAAACCGAAGATGAGGTTCCTTCTCCTGA
ACAGGTTCACCCTGCTGCTCCTGCTCCTAGTGAGCCCTACTCCAGTTCTTCAGGCTCCTACCAATCTCAC
TGACTCCGGCCTTGATCAGGAGCCATTCCTGTACTTGGTTGGACGCAAGAAGCTTCTGGATGCTCAGTAC
AAGTGCTATGACCGGATTCAGCAGTTGCCCCCTTATGAGGGAGAAGGTCCATATTGCAACCGAACTTGGG
ATGGATGGATGTGCTGGGACGACACTCCAGCTGGTGTAATGTCCTATCAGCACTGCCCTGACTACTTTCC
GGACTTTGACCCAACAGAAAAGGTTTCAAAATACTGCGATGAAAATGGAGAGTGGTTTAGACACCCTGAC
AGCAACCGAACCTGGTCCAACTACACTCTGTGCAATGCCTTCACTCCTGACAAACTGCATAATGCATACG
TTCTTTATTACCTAGCACTTGTGGGCCACTCCATGTCAATTGCTGCTCTGATTGCTTCCATGGGGATCTT
CTTGTTTTTCAAGAACCTTAGCTGCCAGAGAGTGACTCTGCACAAGAACATGTTCCTCACTTATATCCTG
AACTCTATCATTATCATCATCCACCTGGTTGAGGTTGTGCCCAATGGAGACCTGGTGCGACGGGATCCTA
TGCATATTTTTCATCATAACACATATATGTGGACAATGCAGTGGGAACTGTCACCACCCTTACCCCTGAG
TGCACACGAGGGAAAGATGGACCCTCATGACAGTGAAGTGATAAGTTGCAAGATTCTGCACTTTTTCCAT
CAGTACATGATGGCTTGCAACTACTTCTGGATGCTGTGTGAGGGGATCTATCTTCACACTCTGATCGTCA
TGGCTGTGTTCACCGAGGATCAACGTCTGCGCTGGTACTATTTACTTGGCTGGGGGTTCCCAATAGTGCC
AACTATTATCCATGCCATTACTCGTGCCGTCTACTACAACGACAACTGTTGGCTGAGTACGGAGACCCAC
TTGCTTTACATCATCCATGGACCCGTCATGGCGGCTCTGGTGGTCAACTTCTTCTTTCTGCTCAACATTG
TCCGTGTGCTTGTGACCAAGATGAGGCAAACCCATGAAGCCGAGGCCTACATGTACCTGAAGGCTGTAAA
GGCCACCATGGTCCTTGTGCCCCTGCTGGGGATCCAGTTTGTTGTGTTTCCCTGGAGGCCCTCCAACAAA
GTGCTTGGGAAGATCTATGATTATCTCATGCACTCTCTGATTCATTTCCAGGGATTCTTTGTCGCGACTA
TCTACTGCTTCTGTAACCATGAGGTGCAAGTGACCCTGAAGCGTCAGTGGGCGCAGTTCAAGATCCAGTG
GAGCCATCGCTGGGGTAGGCGCCGCCGCCCCACCAACCGAGTGGTTAGCGCTCCTCGTGCTGTAGCCTTT
GCAGAACCAGGTGGCCTCCCCATTTACATCTGCCATCAGGAACCAAGGAATCCTCCAGTCAGCAACAACG
AAGGCGAAGAGGGTACTGAAATGATCCCCATGAATGTCATCCAGCAAGACTCATCCGCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_053816
ORF Size 1602 bp
Insert Size 1602
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_053816.2, NP_446268
RefSeq Size 3544
RefSeq ORF 1602
Locus ID 116506
Cytogenetics 4q13
Gene Summary receptor for calcitonin; acts via adenylate cyclase signaling [RGD, Feb 2006]. Transcript Variant: This variant (1a, previously called 2), lacks an alternate in-frame exon compared to variant 1b. The resulting isoform (1a, previously called b), has the same N- and C-termini but is shorter compared to isoform 1b.
Transcript Variant: This variant (1b), previously called 1, represents the longer variant and encodes the longer isoform (1b, previously called a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)