Egr1 (NM_007913) Mouse Tagged ORF Clone

CAT#: MR227136

Egr1 (Myc-DDK-tagged) - Mouse early growth response 1 (Egr1)

Clone Modification / Custom Cloning Service

  • TrueORF®

USD 389.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Egr1 (NM_007913) Mouse Tagged ORF Clone
Symbol Egr1
Synonyms A530045N19Rik; egr; Egr-1; ETR103; Krox-1; Krox-24; Krox24; NGF1-A; NGFI-A; NGFIA; TIS8; Zenk; Zfp-6;
Vector pCMV6-Entry
Sequence Data
ORF Nucleotide Sequence
>MR227136 representing NM_007913
Red=Cloning site Blue=ORF Green=Tags(s)

CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCGGCGC
GCCGGCGCGCCC

ATGGCAGCGGCCAAGGCCGAGATGCAATTGATGTCTCCGCTGCAGATCTCTGACCCGTTCGGCTCCTTTC
CTCACTCACCCACCATGGACAACTACCCCAAACTGGAGGAGATGATGCTGCTGAGCAACGGGGCTCCCCA
GTTCCTCGGTGCTGCCGGAACCCCAGAGGGCAGCGGCGGTAATAGCAGCAGCAGCACCAGCAGCGGGGGC
GGTGGTGGGGGCGGCAGCAACAGCGGCAGCAGCGCCTTCAATCCTCAAGGGGAGCCGAGCGAACAACCCT
ATGAGCACCTGACCACAGAGTCCTTTTCTGACATCGCTCTGAATAATGAGAAGGCGATGGTGGAGACGAG
TTATCCCAGCCAAACGACTCGGTTGCCTCCCATCACCTATACTGGCCGCTTCTCCCTGGAGCCCGCACCC
AACAGTGGCAACACTTTGTGGCCTGAACCCCTTTTCAGCCTAGTCAGTGGCCTCGTGAGCATGACCAATC
CTCCGACCTCTTCATCCTCGGCGCCTTCTCCAGCTGCTTCATCGTCTTCCTCTGCCTCCCAGAGCCCGCC
CCTGAGCTGTGCCGTGCCGTCCAACGACAGCAGTCCCATCTACTCGGCTGCGCCCACCTTTCCTACTCCC
AACACTGACATTTTTCCTGAGCCCCAAAGCCAGGCCTTTCCTGGCTCGGCAGGCACAGCCTTGCAGTACC
CGCCTCCTGCCTACCCTGCCACCAAAGGTGGTTTCCAGGTTCCCATGATCCCTGACTATCTGTTTCCACA
ACAACAGGGAGACCTGAGCCTGGGCACCCCAGACCAGAAGCCCTTCCAGGGTCTGGAGAACCGTACCCAG
CAGCCTTCGCTCACTCCACTATCCACTATTAAAGCCTTCGCCACTCAGTCGGGCTCCCAGGACTTAAAGG
CTCTTAATACCACCTACCAATCCCAGCTCATCAAACCCAGCCGCATGCGCAAGTACCCCAACCGGCCCAG
CAAGACACCCCCCCATGAACGCCCATATGCTTGCCCTGTCGAGTCCTGCGATCGCCGCTTTTCTCGCTCG
GATGAGCTTACCCGCCATATCCGCATCCACACAGGCCAGAAGCCCTTCCAGTGTCGAATCTGCATGCGTA
ACTTCAGTCGTAGTGACCACCTTACCACCCACATCCGCACCCACACAGGCGAGAAGCCTTTTGCCTGTGA
CATTTGTGGGAGGAAGTTTGCCAGGAGTGATGAACGCAAGAGGCATACCAAAATCCATTTAAGACAGAAG
GACAAGAAAGCAGACAAAAGTGTGGTGGCCTCCCCGGCTGCCTCTTCACTCTCTTCTTACCCATCCCCAG
TGGCTACCTCCTACCCATCCCCTGCCACCACCTCATTCCCATCCCCTGTGCCCACTTCCTACTCCTCTCC
TGGCTCCTCCACCTACCCATCTCCTGCGCACAGTGGCTTCCCGTCGCCGTCAGTGGCCACCACCTTTGCC
TCCGTTCCACCTGCTTTCCCCACCCAGGTCAGCAGCTTCCCGTCTGCGGGCGTCAGCAGCTCCTTCAGCA
CCTCAACTGGTCTTTCAGACATGACAGCGACCTTTTCTCCCAGGACAATTGAAATTTGC


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites AscI-MluI      Cloning Scheme for this gene      Plasmid Map     
Tag Myc-DDK
ACCN NM_007913
ORF Size 1599 bp
OTI Disclaimer The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Product Components The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Reference Data
RefSeq NM_007913.1, NM_007913.2, NM_007913.3, NM_007913.4, NM_007913.5, NP_031939
RefSeq Size 3072
RefSeq ORF 1602
Locus ID 13653
Cytogenetics 18 B1|18 18.76 cM
MW 57 kDa
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations