Qpct (NM_027455) Mouse Tagged ORF Clone

  • TrueORF®
SKU
MG216989
Qpct (tGFP-tagged) - Mouse glutaminyl-peptide cyclotransferase (glutaminyl cyclase) (Qpct), (10ug)
  $425.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Tagged ORF Clone
Target Symbol Qpct
Synonyms 5730422A13Rik
Vector pCMV6-AC-GFP
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
ORF Nucleotide Sequence
>MG216989 representing NM_027455
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGGCAGCGAAGACAA

ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAA
Protein Sequence
>MG216989 representing NM_027455
Red=Cloning site Green=Tags(s)

MAGSED

TRTRPLE - GFP Tag - V
Restriction Sites SgfI-MluI Cloning Scheme for this gene | Plasmid Map
ACCN NM_027455
ORF Size 20 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_027455.2, NP_081731.1
RefSeq Size 1924 bp
RefSeq ORF 1089 bp
Locus ID 70536
UniProt ID Q9CYK2
Cytogenetics 17 E3
Summary Responsible for the biosynthesis of pyroglutamyl peptides. Has a bias against acidic and tryptophan residues adjacent to the N-terminal glutaminyl residue and a lack of importance of chain length after the second residue (By similarity).UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_027455" in other vectors (4)
SKU Description Size Price
MC211077 Qpct (untagged) - Mouse glutaminyl-peptide cyclotransferase (glutaminyl cyclase) (Qpct), (10ug) 10 ug
$686.00
MR216989 Qpct (Myc-DDK-tagged) - Mouse glutaminyl-peptide cyclotransferase (glutaminyl cyclase) (Qpct) 10 ug
$225.00
MR216989L3 Lenti ORF clone of Qpct (Myc-DDK-tagged) - Mouse glutaminyl-peptide cyclotransferase (glutaminyl cyclase) (Qpct) 10 ug
$525.00
MR216989L4 Lenti ORF clone of Qpct (mGFP-tagged) - Mouse glutaminyl-peptide cyclotransferase (glutaminyl cyclase) (Qpct) 10 ug
$525.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.