(BC022774) Mouse Tagged ORF Clone

CAT#: MG200002

MGC:32192 (GFP-tagged) - Mouse cDNA clone MGC:32192 IMAGE:5006129

Clone Modification / Custom Cloning Service

  • TrueORF®

USD 351.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name (BC022774) Mouse Tagged ORF Clone
Vector pCMV6-AC-GFP
Sequence Data
>MG200002 representing BC022774
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGTGTCGCTGTCCCCTACAGCCCAGGTCCCTCTGTGCTGTGCCCCTCAGCCACCTCTATCATCCTGT
CC


ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAA
>MG200002 representing BC022774
Red=Cloning site Green=Tags(s)

MGVAVPYSPGPSVLCPSATSIILS

TRTRRLE - GFP Tag - V
Restriction Sites SgfI-MluI      Cloning Scheme for this gene      Plasmid Map     
Tag TurboGFP
ACCN BC022774
ORF Size 74 bp
OTI Disclaimer The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Product Components The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Reference Data
RefSeq BC022774
RefSeq Size 571
RefSeq ORF 74
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.