Adgrb2 (NM_001290714) Mouse Untagged Clone

CAT#: MC229601

Bai2 (untagged) - Mouse brain-specific angiogenesis inhibitor 2 (Bai2), transcript variant 4

USD 1,412.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Adgrb2 (NM_001290714) Mouse Untagged Clone
Symbol Adgrb2
Synonyms Bai2
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC229601 representing NM_001290714
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCCCAGCCTGTCCCCTCTTACTGTCTGTGATTCTGTCCCTGCGCCTGGCCACGGCCTTCGACCCTG
CCCCCAGTGCCTGCTCTGCCCTGGCCTCGGGCGTGCTCTACGGGGCCTTCTCGCTGCAGGACCTCTTTCC
CACCATCGCCTCGGGCTGCTCCTGGACCCTGGAGAACCCAGACCCCACCAAGTACTCCCTCTACCTGCGC
TTCAACCGGCAGGAGCAGGTTTGCACACACTTTGCCCCGCGCCTGCTGCCCCTGGACCACTACCTGGTCA
ACTTTACCTGCCTGCGGCCTGGTCCAGAGGAAGCCACAGCCCGGGCTGAGTCGGAGGTGGGACGGCCAGA
GGAGGAGGAGGAGGAGGCGGCGGCAGCAGCATCAGGGTTGGAGTTGTGTGGTGGCTCAGGCCCCTTTACC
TTTCTGCACTTCGACAAGAACTTTGTGCAGCTGTGCCTGTCGGCTGAGCCCTCTGAGGCCCCTCGTCTGC
TAGCGCCTGCTGCCCTGGCCTTCCGTTTTGTGGAGGTCTTGCTGATCAACAACAACAACTCCAGCCAGTT
CACCTGTGGTGTGCTCTGCCGCTGGAGTGAGGAGTGTGGCCGGGCTGCAGGCAGGGCTTGTGGCTTTGCA
CAGCCAGGGTGTAGTTGTCCTGGGGAGGCAGGGGCCAACCCCGCCACCACCACATCTCCGGGGCCTCCGG
TTGCCCACACCCTGTCCAATGCCCTGGTGCCCGGGGGCCCAGCCCCTCCTGCTGAGGCCGACTTGCACTC
GGGGAGCAGCAATGACCTGTTCACCACCGAGATGAGATATGGTGAGGAGCCGGAAGAGGAACCGAAGGTG
AAAACCCAGTGGCCAAGGTCTGCAGATGAGCCTGGGCTATACATGGCGCAGACAGGCGACCCAGCAGCTG
AGGAGTGGTCCCCGTGGAGCGTGTGTTCCCTGACGTGTGGGCAGGGTCTGCAGGTGCGGACCCGCTCCTG
CGTGTCCTCCCCCTATGGGACCCTGTGCAGCGGGCCCCTTCGGGAGACCCGGCCTTGCAACAATTCAGCC
ACCTGCCCAGTGGAAGGCCAGTGGCTAGAATGGGGTCCCTGGGGCCCATGCTCATCATCTTGTGCCAATG
GGACCCAGCAGCGCAGCCGGAAATGCAGTGTGGCGGGTCCAGCCTGGGCCACGTGCGCAGGTGCCCTCAC
GGATACCCGTGAGTGCAGCAATCTCGATTGCCCGGCCACTGACGGCAAGTGGGGGCCGTGGAACGCGTGG
AGCCTGTGCTCCAAGACGTGTGACACGGGCTGGCAACGCCGCTTCCGCATGTGCCAGGCTTCTGGCACAC
AGGGCTACCCTTGCGAGGGCACAGGAGAGGAGGTGAAACCCTGCAGTGAGAAGAGGTGTCCAGCCTTCCA
TGAGATGTGCAGGGATGAGTACGTGATGTTGATGACATGGAAGAGGGCGGCAGCTGGCGAGATCATTTAC
AACAAGTGTCCCCCTAATGCCTCGGGTTCTGCTAGCCGCCGCTGTCTCCTCAGTGCCCAGGGCGTAGCAT
ACTGGGGACTGCCCAGCTTTGCTCGTTGCATATCCCATGAATACCGCTACCTGTACCTGTCACTTCGGGA
ACACCTGGCTAAGGGCCAGCGCATGCTGGCAGGTGAGGGCATGTCACAGGTGGTGCGGAGCCTGCAGGAG
CTACTGGCACGGCGCACTTACTACAGCGGGGACCTGCTCTTCTCTGTGGACATCCTAAGGAACGTCACTG
ACACCTTCAAGAGGGCCACCTATGTCCCTTCCGCCGATGACGTGCAGCGTTTCTTCCAGGTGGTGAGCTT
CATGGTGGATTCAGAAAACAAGGACAAATGGGATGATGCTCAGCAGGTGTCACCGGGCTCTGTGCACCTG
CTGCGTGTTGTGGAAGATTTCATTCACCTCGTGGGCGACGCTCTCAAGGCCTTCCAGAGCTCTCTCATTG
TCACGGACAATCTGGTGATCAGCATTCAGAGAGAGCCTATCTCCGCCGTGTCCAGTGACATCACGTTTCC
CATGCGGGGCCGCAGGGGCATGAAGGACTGGGTGCGACACTCAGAGGATCGTCTCTTTCTACCCAAGGAG
GTGCTCAGCCTGTCCTCCCCAGGAAAGCCAGCCACACCTGGGGCAGCCACAGCAGGCAGCCCGGGCAGGG
GGAGGGGCCCAGGAACGGTGCCCCCTGGCCCAGGCCACGCCCACCAGCGCCTTCTCCCAGCTGACCCCGA
AGAGTCCTCCTCCTACTTTGTGATCGGTGCTGTGCTCTACCGCACCCTTGGCCTCATCCTGCCGCCCCCC
AGGCCTCCACTTGCTGTCACCTCCCGGGTGATGACAGTGACTGTGCGTCCCCCCACCCAGCCTCCAGCTG
AGCCCCTCATTACAGTGGAACTCTCGTACATCATCAATGGCACCACCGATCCCCACTGTGCCAGCTGGGA
CTACTCCAGAGCAGATACCAACTCGGGGGACTGGAACACTGAGAGCTGCCAGACCTTGGAGACCCAGGCG
GCTCACACCCGCTGCCAGTGCCAGCACCTGTCCACCTTTGCCGTCCTGGCCCAGCCACCCAAGGACCTGA
CCCTGGAGCTGGCAGGTGCTCCCTCTGTCCCCCTGGTGATCGGCTGTGCAGTGTCCTGCATGGCTCTGCT
CACCCTGCTGGCCATCTATGCAGCCTTCTGGAGGTTTATAAAATCAGAACGCTCCATCATCTTGCTGAAC
TTCTGCCTGTCCATCCTGGCTTCCAACATTCTGATCCTGGTGGGCCAGTCCCGGGTGCTGAGCAAGGGCG
TATGCACCATGACGGCTGCCTTCCTACACTTCTTCTTTCTGTCCTCCTTTTGCTGGGTGCTTACAGAGGC
CTGGCAATCCTATCTGGCTGTCATCGGGCGGATGCGCACCCGCCTGGTTCGCAAGCGCTTCCTCTGCCTG
GGCTGGGGTCTACCTGCCCTGGTGGTGGCTGTGTCTGTTGGCTTTACTCGCACCAAAGGATATGGTACAT
CCAGCTACTGCTGGCTGTCCCTAGAGGGCGGCCTGCTCTATGCCTTCGTGGGTCCAGCAGCAGTCATTGT
CCTGGTGAACATGCTCATCGGGATTATCGTCTTCAACAAGCTCATGGCTCGCGATGGCGTCTCAGACAAA
TCTAAGAAGCAGAGGGCTGGGGCTTCACTCTGGAGTTCCTGCGTGGTACTGCCTCTCCTGGCGCTTACCT
GGATGTCTGCCGTCCTGGCCATGACAGATCGCCGCTCCGTCCTCTTCCAGGCACTCTTTGCCGTTTTCAA
CTCTGCACAAGGCTTTGTCATCACCGCTGTGCACTGCTTCCTGCGCCGAGAGGTCCAGGATGTGGTAAAG
TGTCAGATGGGTGTGTGTCGGGCTGATGAGAGTGAAGACTCCCCAGACTCGTGCAAGAACGGGCAGCTGC
AGATCCTGTCAGACTTTGAAAAGGACGTGGATCTGGCTTGTCAGACAGTTCTGTTCAAGGAGGTCAACAC
CTGCAACCCGTCCACCATTACCGGCACTCTGTCCCGCCTGTCTCTGGATGAGGATGAGGAGCCCAAGTCC
TGTCTCGTGGGTCCTGAGGGTGGCCTCAGCTTCTCACCACTGCCTGGGAACATCCTGGTACCCATGGCAG
CCTCACCAGGTCTAGGGGAGCCACCACCACCCCAGGAGACCAACCCTGTGTACATGTGTGGGGAGGGTGG
CCTGCGGCAGTTGGACCTTACATGGATACGGCAGAGTGAACCAGGCTCTGAGGGGGACTACATGGTTCTG
CCCCGGCGGACTTTGAGCCTGCAGCCTGGTGGTGGGGGTACAGCGGGTGAGGAGGCCCCAAGGGCCCGGC
CTGAGGGGACCCCCCGGCGGGCTGCCAAAACGGTAGCCCACACTGAAGGCTACCCCAGCTTCCTGTCTGT
GGAGCACTCGGGTCTAGGGCTGGGCCCTGCCTATGGGTCTCTCCAGAACCCGTATGGAATGACCTTCCAA
CCACCACCACCAACACCCAGCGCCCGCCAAGTACCAGAGCCAGGAGAACGTAGCCGGACCATGCCCCGTA
CAGTGCCTGGTTCCACCATGAAGCTGGGCTCCCTTGAGCGAAAGAAGCTTCGGTATTCGGACTTGGACTT
TGAGAAGGTGATGCACACTCGGAAACGGCACTCGGAACTCTACCACGAACTCAACCAGAAGTTCCACACT
TTCGACCGCTACCGTAGCCAGTCCTCAGCCAAGGAGAAACCCAGCCCCCCCGGGGGACGCCCTGGCTTGT
CCCAGCACAGGAGGCATCAAAGCTGGAGCACCTTCAAATCTATGACACTGGGCTCACTGCCCCCCAAGCC
CCGAGAACGGCTGGCCCTGCACCGGACAGCAGCCTGGGAGCCCACAGAACCGCCAGACGGCGACTTCCAG
ACAGAGGTGTGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
Tag Tag Free
ACCN NM_001290714
ORF Size 4422 bp
Insert Size 4422
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001290714.1, NP_001277643
RefSeq Size 5185
RefSeq ORF 4422
Locus ID 230775
Cytogenetics 4|4 D2.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.