Radil (NM_001289588) Mouse Untagged Clone

CAT#: MC229365

Radil (untagged) - Mouse Ras association and DIL domains (Radil), transcript variant 1

USD 1,041.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Radil (NM_001289588) Mouse Untagged Clone
Symbol Radil
Synonyms AI536456; D930005D10Rik
Vector pCMV6-Entry
Sequence Data
>MC229365 representing NM_001289588
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTTTATGGGACTCAGTTGATCATGTCTCCTCCCACCAAGAATAAGCTGAAGCGACAGAGCCAGCTCC
TATCCACAATGCTGTCCCGGACACTGAGCTACAAGTATCGTGACCTGGATTCCACCTTCTGCAGCCTAGG
TGCCAGTGACGACCCCTCAGAGCTCTCCACGCAGCTCTCGGCCCCCGGGGTCCTCAAGGTGTTTGGGGAC
AGTGTCTGTACAGGCACCCACTATAAGAGTGTCTTGGCCACTGGCTCCTCCAGTGCCCAGGAGCTGGTGA
AAGAGGCACTGGAGCGCTATGCCCTGGACCCTGAGTGTGCTGGCCAGTACGTGCTATGTGATGTTGTGGG
CCAAGCTGGGGACTCTGGGCAGCGGTGGCAGGCCCAGTGCTTCCGAGTATTTGGCGACAATGAGAAGCCC
CTCTTGATCCAGGAGTTATGGAAACCCCGAGAAGGCTTGTCCCGGAGGTTTGAGCTAAGGAAGAAGTCAG
ATGTGGAAGAGCTTGCATCGAGGGATGTGGATACCACCACCGCAGGGATAAACGCCCAAGCCCGGAGGCT
ACAGCGTATCCGTGCCAAGGGAACCCCAGCCCTCACCTCTGAAGCTGCTCAAAGCTCCCCACCGACCAGG
CTGCGCCGTACAGTCAGCGAGACCAGCCTAAGCCCAGCACCATCGCTACCTGAGGCTGCTCAGAGGCCTG
AGGAGCCCGTCCCTGAGGCCATGCGTTACTCGCTGTACCAGTGCCCGCACCTGCTGCTGTTGCAGGGCTA
CAGCCAGCAGCACGACAGCCTGGTGTACGTGCTCAGCAAGGAACGGCACACAGTGGGCCAGCGCACACCG
TCTAGCAAACCCAGCATCAGCTTGTCTGCCCCAGACATCCTGCCCCTGCACTGTACCATTCGCCGCCATC
AGTCCCCAGAGGGTGGCCCGGCAGGGACCAGGCTAGTGCTGGAGCCCATCACAGGGGCTTCGGTGTCAGT
CAACTTCTCAGAAGTGGGAAGGAACCCTGTGGTGCTACAACATGGCGACCTGCTCTCCCTGGGTCTCTAT
TACCTGCTGCTGTTCAAGGACCCTGGGCAGGCACAGCCACTGCCTGCTTGTGCCCTCGCCCGTCTTGGGG
CGGCACCACAGAGCTGTAGAATGTGTGGTGCGGTGCTCAGAGCCCGTGGGGCCCCTTCCTTGCCTGCTGC
TGTGGTCCGGCGGCGGTCACTGCTCCTGGAGTTTGAGCCCGATGTGGAGGACACACTGCTGCAGAGGATC
ATGACACTGATTGAGCCTGGGGGTGACGACCACAAGCTGACACCTGCCTTCCTCCTCTGCCTCTGCATCC
AGCACTCCGCCATGCACTTCCAGCCGGGTACCTTCAGGCATCTCCTGCTCAAGATCTCCAAAAGGGTCCG
AGACACTGTCTGGGAGAAGACCAAAGAACTAGCGGAAAAGCAGGCACAACTCCAGGAGCCCATCTCCTGG
GCCAGCTTCCCCATGGCCGACCTGGTTCCCGACCTGCAGCACATCCTGTTTTGGATGTCAAACTCCATCG
AGCTCCTGTACTTCATCCAGCAGAAGTCCCCGCTGTACGTGCAGAGCATGGAGGAGGAGCTGGACGTCAC
AGGCTCCAAGGAGTCGCTGTTCTCCTGCACACTGACGGCCAGCGAGGAGGCCATGGCTGCCCTGGAGGAG
GTGGTGCTCTATGCTTTCCAGCAGTGCGTGTATTACCTCTCCAAGTGCTTGTATGTCTGCCTCCCGGCCC
TCTTGGAATGCCCCCCATTTCAGACAGAGCGCAGGGAGAGCTGGCGCTCAGGTCCAGCTCTGCCCGAGGA
GCTTCGGCGAGTGGTGTCAGTGTTCCAGGCCACCTTGGACCTCCTGCAGCAGCTGCAGATGCATCCTGAG
GTGGCCTCCCAGATGCTGGCTTATCTCTTCTTCTTCTCTGGCACACTGCTCCTCAACCAGGTCCTAGACA
AGGGGCCCTCTCTGAGTTGCTTCCATTGGCCCAGGGGTGTGCAGGTGTGTGCCCGCCTGCAGCAGTTCCT
GGAGTGGGCCCGGAGTGCTGGCCTTGGAGCACCTGCTGAGCGCTTCTTCCGGAAGCTTTCCTGCACCCTG
CATCTGCTGGCCACTCCCAGGGCTCAGCTCATCCAGATGAGCTGGGCCACCCTGAGGGTCACATTCCCTG
CCCTGAACCCTGCTCAGCTGCACCGGCTTCTGACTCAGTACCAGCTGGCCTCTGCCATGGGCCCTGTGAG
CGCTTGGGAGCCAGGAGCCCCAGACGGCCCGGAGGCCTTCCAGTCAGAGGACATCCTGGAGTCCTATGAA
AACCCGCCGCCCATTGTTCTGCCGAGCCAGGGCTTCCAGGTAGACCTGGAAGCCGACTGCGTGGAGGACA
GCATCTACCAGCACCTGCTCTACATCCGCCACTTCCTGTGGGGGCTGCGGGGCCAAGCCAGCCCTGACAG
TGGGCCTGCCCAGCCCGAGAGCATCGAGGGAGCCATCATGGATACCTGGGCCATCCCCTCCTCTGGGCCT
CAACGTCTGTCCACCTTCTCTTCCCAGGGCCTGTACCACACAATTCCTGAGGGCCATCTGGAAGGCCATG
GCTGCCCCCTGGCCAATAGGGACCCAGGCAGAGTTGCTGTTGAAACTGCCCCTCCCCATTCTCTTCCTGT
CACGGGAGCTCCCCGGGCTCAGGGTCCCCCTGGAAGACAGCCTACCCGAGGGGACCGCAGGGGCTCCCAG
GCTGGCTCTCTGCACACTGACTCCTCCTGCATGCTCACTCCGCCCAGCACGCCACTGGGCCTGGAGCCTG
CAGGCCCCAGCTGGCCAGAGCCCAGCGGCCTCTGTGGAAGAGCAGTCCTTGACGGGCAGAGGAATGGGCC
AGGTGGTCTGCCTGGTGCAGTCCTAGAAGGAGATGCGATTCAGGATGCTGAGCCTCCTGCTGAGGCCTCC
AGCCCCAGCTCCAGCGCTGAGGACTTCTGCTACGTGTTCATGGTGGAGCTGGAGCGAGGCCCCTCGGGGC
TGGGAATGGGCCTGATTGATGGGATGCACACACCTCTGGGGGCCCAGGGACTCTACATACAGACCCTGCT
TCCCGGGAGCCCCGCGGCATCTGATGGGCGGCTGTCACTCGGAGACCAAATCCTGGAGGTGAATGGCAGC
AGCCTGAGGGGTGTCAGCTACATGAGGGCAGTGGATTTGATCCGACATGGAGGCAAGAAGATGCGATTTT
TAGTTGCCAAGTCTGACATGGAAACGGCCAAGAAAATCCGCTTCCGCAATCCCCCTTCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001289588
ORF Size 3282 bp
Insert Size 3282
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001289588.1, NP_001276517
RefSeq Size 3796
RefSeq ORF 3282
Locus ID 231858
Cytogenetics 5|5 G2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.