Brd8 (NM_001289606) Mouse Untagged Clone

CAT#: MC229099

Brd8 (untagged) - Mouse bromodomain containing 8 (Brd8), transcript variant 2

USD 835.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Brd8 (NM_001289606) Mouse Untagged Clone
Symbol Brd8
Synonyms 2610007E11Rik; 4432404P07Rik; SMAP
Vector pCMV6-Entry
Sequence Data
>MC229099 representing NM_001289606
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGACCGGGACAGGCAAGCACAAGCTGCTGAGTACTGGCCCAACAGAGCCATGGTCCATCCGAGAGA
AGTTGTGTTTAGCATCTTCTGTCATGAGGAGTGGGGATCAGAACTGGGTATCAGTTAGCAGAGCAATCAA
GCCCTTTGCAGAACCTGGCCGGCCTCCAGACTGGTTCTCTCAAAAACATTGTGCTTCTCAGTATTCTGAG
CTCTTAGAGACTACTGAGACTCCAAAACGGAAACGGGGTGAAAAAGGAGAAGTGGTAGAAACTGTTGAAG
ATGTTATTGTTCGCAAACTGACTGCTGAGAGAGTTGAAGAACTGAAGAAAGTCATAAAGGAGACACAGGA
GAGATACAGGCGTCTGAAAAGAGATGCAGAACTAATCCAAGCCGGGCACATGGACAGCAGACTGGATGAG
CTCTGCAATGACATTGCAATGAAAAAGAAATTGGAAGAGGAAGAGGCTGAAGTAAAAAGGAAGGCCACCG
ATGCTGCGTACCAGGCGCGACAAGCAGTGAAAACGCCTCCTCGAAGGTTACCGACTGTGATGGTCCGCTC
TCCTGTAGACTCTGCCTCCCCAGGAGGTGATTACCCACTTGGAGACTTGACTCCAACCACTATGGAAGAG
GCTACCTCTGGGGTGAATGAGAGTGAAATGCCTGTACCCCCTGGCCATCTGAACAGCACAGGGGTTCTCT
TGGAGGTAGGAGGGGTTCTTCCCATGATACATGGTGGGGAGATACAGCCAACAACCAGTGCTGTGGCGGC
CTCCCCGGCTGCCTCAGGTGCTCCCACTCTTTCCCGGCTTTTAGAAGCTGGGCCCACACAGTTCACCACT
CCTCTTCCTTCCTTCACTACTGTTGCCAGTGAGCCGCCAGTTAAGCTTGTGCCACCCCCTGTAGAGTCTG
TGTCCCAGGCTACCATTGTCATGATGCCCGCGCTGCCAGCACCATCCTCTGCTGCGGCTGTCTCCACTTC
TGAAAGTGGAGCTCCAGTGAGCCAGCCTGAGCCCTGTGTACCCCTGGAAGCTGTGGGGGATCCACATACT
GTGACTGTTTCCATGGATAGCAATGAAATCTCCATGATCATTAATTCCATCAAAGAAGAGTGTTTCCGCT
CAGGGGTAGCAGAGGCTCCTGGTGGATCAAAGGCTCCAAGCATAGATGGGAAGGAAGACTTGGATCTAGC
GGAGAAGATGGATATTGCTGTGTCTTACACAGGTGAAGAGTTGGACTTTGAAACAGTTGGAGACATCATT
GCCATCATTGAGGACAAGGTGGATGATCACCCTGAAGTGCTGGATGTGGCAGCGGTAGAAGCGGCGTTAT
CGTTCTGTGAAGAGAATGATGACCCTCAGTCCCTGCCTGGCCCCTGGGAGCACCCTATCCAGCAGGAGCG
CGACAAGCCAGTACCTCTGCCAGCACCAGAGATGACAGTCAAACAAGAGAGGCTAGACTTCGAGGAATCA
GAAAACAAAGGGCTCCATGACCTGGTGGACATCAGGGATTCCGGTGTTGAGATTAAGGTGGAACCCACAG
AGCCAGAGCCAGGCATGTCTGGGGCTGAGATAGTAGCTGGAGTTGGTCCAGTTCCAAGTATGGAGCCACC
AGAACTCAGGAGTCAAGACTCAGATGAAGAACCTAGAAGTTCTGCAGCTGGAGACATTGGTGAGGCAGAT
GGTTCCAGTGGGAAAGGCGATGAGAGGCCACTTTCAGCTGTGAAGACAGAGGCATCCCCTGAGAGCATGT
TGTCTCCATCACATGGCTCAAATCTTATTGAAGATCCTTTAGAGGCAGAGACTCAACACAAGTTTGAAAT
GTCAGACTCATTGAAAGAAGAATCAGGGACTATTTTTGGAAGCCAGATAAAGGATGCCCCAGGTGACGAT
GAGGAAGAAGATGGAGTCAGTGAAGCAGCTAGCCTAGAGGAGCCTAAGGAAGAGGATCAAGGAGAAGGCT
ATTTGTCTGAGATGGATAATGAGCCCCCTGTGAGTGAGAGTGATGATGGCTTTAGTATACATAACGCCAC
ACTGCAGTCACACACTCTGGCAGACTCCATCCCAAGCAGCCCTGCCTCCTCCCAGTTTTCCGTGTGCAGT
GAAGATCAAGAAGCAATTCAGGCTCAGAAAATATGGAAGAAAGCCATCATGCTTGTATGGAGGGCTGCAG
CAAATCATAGGTATGCCAATGTGTTCCTGCAACCTGTTACAGATGACATAGCTCCTGGTTACCATAGCAT
TGTACAGAGGCCTATGGATTTGTCAACTATAAAGAAAAACATTGAAAATGGACTGATCCGAAGCACAGCT
GAGTTTCAGCGTGACATCATGCTGATGTTTCAGAATGCTGTTATGTACAATAGCTCAGACCATGATGTCT
ATCACATGGCAGTAGAGATGCAGAGAGATGTCTTGGAACAGATCCAGCAATTCTTGGCCACACAGTTGAT
TATGCAAACATCTGAGTCTGGAATCAGTGCTAAAAGTCTCCGGGGGAGAGACTCTACCCGAAAACAAGAT
GCTTCAGAGAAGGACAGTGTCCCCATGGGCTCTCCTGCCTTCCTTCTCTCTCTCTTTGATGGGGGAACCA
GGGGACGCCGCTGTGCCATTGAAGCAGATATGAAGATGAAGAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001289606
ORF Size 2637 bp
Insert Size 2637
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001289606.1, NP_001276535
RefSeq Size 4511
RefSeq ORF 2637
Locus ID 78656
Cytogenetics 18|18 B1
Gene Summary May act as a coactivator during transcriptional activation by hormone-activated nuclear receptors (NR). Stimulates transcriptional activation by AR/DHTR, ESR1/NR3A1, RXRA/NR2B1 and THRB/ERBA2. Component of the NuA4 histone acetyltransferase (HAT) complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. NuA4 may also play a direct role in DNA repair when recruited to sites of DNA damage. Component of a SWR1-like complex that specifically mediates the removal of histone H2A.Z/H2AFZ from the nucleosome. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.