Trim9 (NM_001286387) Mouse Untagged Clone

CAT#: MC228933

Reviews ()
Write a review

Trim9 (untagged) - Mouse tripartite motif-containing 9 (Trim9), transcript variant 5

  View "NM_001286387" in other vectors (1)

USD 770.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Trim9 (NM_001286387) Mouse Untagged Clone
Symbol Trim9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>MC228933 representing NM_001286387
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGAGATGGAAGAAGAGTTAAAATGCCCTGTGTGTGGCTCCTTCTATCGGGAGCCCATCATCTTGC
CCTGCTCTCACAATTTATGTCAGGCGTGCGCCCGCAACATCCTGGTGCAGACCCCGGAGTCCGAGTCCCC
CCAGAGCCGCCGGGCCTCGGGCTCTGGGGTTTCTGACTATGATTATCTGGACCTGGACAAGATGAGCCTG
TACAGCGAGGCGGACAGCGGCTATGGCTCCTACGGAGGTTTCGCCAGCGCCCCCACTACCCCGTGCCAGA
AGTCGCCCAACGGCGTCCGCGTTTTCCCCCCTGCTATGCCGCCACCGCCCACCCACCTGTCACCGGCTTT
GGCCCCTGTGCCCCGCAATTCCTGCATCACCTGCCCCCAGTGCCACCGCAGCCTCATTCTGGATGACCGG
GGGCTCCGCGGTTTCCCCAAGAACCGCGTCCTGGAAGGGGTCATCGACCGCTACCAACAGAGCAAAGCCG
CGGCCCTCAAGTGCCAGCTCTGCGAGAAGGCGCCCAAGGAAGCCACGGTCATGTGTGAACAGTGCGATGT
CTTCTACTGCGACCCTTGCCGTCTGCGCTGCCACCCGCCCCGGGGTCCCCTAGCCAAACACCGTCTGGTG
CCCCCGGCCCAGGGCCGCGTCAGCCGGCGGCTGAGCCCGCGCAAGGTCTCCACCTGCACAGACCACGAGC
TGGAGAACCACAGCATGTACTGCGTGCAATGCAAGATGCCCGTGTGCTACCAGTGCCTAGAGGAGGGCAA
ACACTCCAGCCACGAAGTCAAGGCTTTGGGGGCTATGTGGAAATTGCACAAGAGCCAGCTCTCCCAGGCC
CTGAATGGATTGTCGGACAGGGCCAAAGAAGCCAAGGAGTTCCTGGTGCAGCTCCGCACCATGGTACAAC
AGATCCAGGAAAACAGTGTGGAGTTTGAGGCCTGCCTGGTGGCCCAGTGTGATGCGCTCATCGATGCCCT
AAACCGAAGGAAGGCTCAGCTGCTGGCCCGGGTCAACAAGGAGCATGAACACAAGCTGAAGGTGGTTCGG
GACCAGATCTCTCACTGCACGGTGAAGCTGCGTCAGACCACGGGCCTCATGGAGTACTGCTTGGAAGTGA
TTAAGGAGAACGACCCCAGTGGCTTTTTGCAGATTTCAGATGCTCTCATAAGGCGAGTTCACTTAACTGA
GGACCAGTGGGGGAAGGGCACCCTCACTCCCAGGATGACCACAGACTTTGATCTGAGCCTGGACAACAGC
CCTCTGCTGCAGTCTATTCACCAACTGGACTTCGTGCAAGTGAAAGCCTCCTCTCCAGTCCCAGCAACCC
CCATCCTACAGCTGGAGGAGTGTTGCACCCACAACAACAGTGCTACGCTGTCCTGGAAACAGCCCCCTCT
GTCCACCGTAGCCGCCGATGGATACATCCTGGAGCTGGATGACGGCAGTGGTGGTCAGTTCCGGGAAGTG
TATGTTGGAAAAGAAACAATGTGCACAGTGGACGGCCTTCACTTCAACAGCACATACAACGCTCGGGTTA
AGGCCTTCAACAAAACAGGAGTCAGCCCCTACAGCAAGACACTGGTCCTCCAGACGTCTGAGGCGGGAGC
CCATGAGACAAAACCTATGAAGGACACAGACTCAGAAGAACAGACCCTCCCCTTTCCAGTGCCTTCGGAA
AGATTGCCGCTCCGTAGGATGAGCCCTTTCTCCTCCACCCTTAATCTACAACCCAGCTTCCCCGGGAGGT
CCTACTTTGATTTCCGGTCCTCACCCCACCAGCTGAGTTTGCATTCTTCTTTACAGTCTCTCAATGCACC
GGGCTGCAATTTTGAGACACAATCTGCATCCTACTCTCAATTAGTTGACATTAAAAAGCTGTTGGCAGTG
GCTTGGTTTGCTTTTGACCCCGGCTCGGCCCACTCCGACATCATCTTCTCCAATGACAACTTGACAGTGA
CGTGCAGTAGCTACGATGACCGGGTGGTGCTGGGGAAAACCGGCTTCTCCAAAGGCGTCCACTACTGGGA
GCTGACCATAGATCGCTATGACAACCACCCTGATCCAGCATTTGGCGTGGCTCGCATCGATGTGATGAAG
GATATGATGTTAGGGAAGGACGACAAAGCTTGGGCAATAACTGAAGGAGGGATCACAAAAGGGGCCACCA
TCGGGGTCCTCCTCGACTTAAACAGAAAGACATTAACGTTTTTCGTCAACAATGAACAGCAAGGCCCCAT
AGCGTTTGAGAACGTGGAGGGCCTGTTCTTCCCTGCTGTCAGCCTGAACAGGAATGTGCAGGTCACGCTC
CACACCGGGCTTCCGGTCCCCGACTTCTACTCCAGCCGAGCTTCCATAGCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001286387
ORF Size 2364 bp
Insert Size 2364
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001286387.1, NP_001273316
RefSeq Size 4677
RefSeq ORF 2364
Locus ID 94090
Cytogenetics 12 C2

Other Versions

Other products for "Trim9"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones