Ttk (NM_001284272) Mouse Untagged Clone

CAT#: MC228911

Ttk (untagged) - Mouse Ttk protein kinase (Ttk), transcript variant 3

USD 742.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ttk (NM_001284272) Mouse Untagged Clone
Symbol Ttk
Synonyms AL022661; esk; Esk1; Mps1; PYT
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC228911 representing NM_001284272
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGCTGAAGAGTTAATTGGCAGCAGTGTGACGATTGATTCCATCATGAGCAAAATGAGAGATATTA
AAAATAAGATAAATGAAGACTGTACTGATGAGCTAAGCTTGTCTAAAATCTGTGCCGATCACACGGAAAC
TGTTAACCAAATTATGAGGGTTGGGAACACCCCAGAGAACTGGTTGAATTTCTTGCTGAAACTAGAGAAA
AACAGCTCACCTCTAAATGACGATCTTTTAAATAAGCTGATTGGTCGGTATAGTCAAGCGATTGAAGTAC
TTCCTCCAGATAAATACGGCCAGAATGAGAGCTTTGCTCGAATACAAGTGAGACTTGCTGAACTAAAAGC
TATTCAAGAGCCTGATGATGCCCGTGACTACTTCCAGATGGCCAGGGAAAACTGCAAGAAGTTTGCTTTT
GTGCACGTATCTTTTGCACAGTTTGAACTGTCTCAAGGCAATCTTAAAAAAAGTGAGCAGCTTCTTCATA
AAGCTGTAGAGACTGGGGCGGTGCCGCTGCAGATGCTGGAGACGGCCATGCGTAACTTACACCTCCAGAA
AAAGCAGCTGCTTCCGGAGGAGGACAAGAAGAGTGTGTCAGCATCGACAGTACTAAGTGCCCAAGAGCCG
TTCTCCAGCTCACTTGGAAATGTACAGAATCGGAGCATCAGCTGTGAGTCCAGAGGACAGGCTGGGGCAG
CCAGGGTTTTATATGGAGAGAACTTGCCTCCACAAGATGCCGAAGTGAGGCATCAAAACCCCTTCAAGCA
GACTCACGCAGCTAAACGGTCATGCCCCTTTGGAAGAGTCCCAGTCAATCTTCTAAACAGCCCAGATTTC
TATGTGAAGACAGATAGCTCAGCTGTGACACAGTTAACAACAAGAAAGGGGTCAGGACCAGACCGAGACG
CGATTCTGCCCGGCTCCAGACCACGTGGCAGTGATTCCTATGAACTGAGAGGTTTAAAGCCCATTCAAAC
TATCTATTTGAAAGACTCTTTGGTGTCCAATGAAAAGAGTTCTGAACTTATGTCTGATTTAATAGCCTTG
AAGAGTAAAACAGATTCAAGTCTAACAAAATTGGAAGAAACTAAGCCAGAGATTGCAGAAAGAAGGCCCA
TGCAGTGGCAGTCTACCAGAAAGCCCGAGTGTGTGTTCCAGAACCCTGCTGCCTTTGCACCCCTGCGGCA
CGTTCCAGATGTCACCCCGAAGGCTGACAAAGAGTCACCACCAATATCAGTTCCTAAATGGCTTGATCCA
AAGTCTGCTTGTGAGACACCTAGTAGCAGCTCCTTGGATGATTACATGAAATGTTTTAAGACTCCAGTTG
TAAAGAATGACTTTCCACCTGCCTGTCCATCATCAACACCTTACAGCCAGCTTGCCCGCCTCCAGCAGCA
ACAGCAGCAGGGACTCAGCACTCCTCTTCAAAGCTTGCAGATTTCAGGTTCTTCATCAATAAATGAATGC
ATTTCAGTTAACGGAAGAATTTATTCCATATTAAAGCAGATAGGCAGTGGAGGTTCCAGTAAGGTGTTTC
AGGTATTGAATGAGAAAAAACAGATAAACGCTATCAAATATGTGAACCTAGAAGACGCCGATAGCCAAAC
TATTGAGAGCTACCGCAACGAGATAGCGTTTTTGAACAAACTACAGCAACACAGTGATAAGATCATCCGC
CTCTATGATTATGAAATCACCGAGCAGTACATCTACATGGTAATGGAATGTGGAAACATTGACCTAAATA
GTTGGCTTAAAAAGAAAAAATCCATCAATCCATGGGAACGCAAGAGCTACTGGAAAAACATGTTGGAGGC
AGTACACATAATCCATCAGCATGGTATTGTTCATAGTGATCTGAAGCCTGCTAACTTTGTGATAGTGGAT
GGAATGCTAAAGCTAATTGATTTTGGGATTGCAAACCAAATGCAGCCAGACACAACAAGCATTGTTAAAG
ATTCTCAGGTCTCTAAACTGCACGCCATAATCAACCCTGCTCATGAGATTGAATTTCCCGAGATTTCGGA
AAAAGATCTTCGAGACGTGTTAAAGTGCTGTTTAGTGAGGAACCCTAAAGAGAGGATATCTATCCCTGAG
CTTCTCACACATCCGTATGTTCAAATTCAGCCCCATCCAGGCAGCCAAATGGCTAGGGGAGCCACTGATG
AAATGAAATATGTGTTGGGTCAACTTGTTGGTCTGAATTCTCCTAACTCCATCTTGAAAACTGCAAAAAC
TTTGTATGAACGTTATAATTGTGGTGAAGGTCAAGATTCTTCGTCATCCAAGACTTTTGACAAAAAGAGA
GAAAGAAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001284272
ORF Size 2322 bp
Insert Size 2322
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001284272.1, NP_001271201
RefSeq Size 2733
RefSeq ORF 2322
Locus ID 22137
Cytogenetics 9|9 E2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.