App (NM_001198824) Mouse Untagged Clone

CAT#: MC228854

App (untagged) - Mouse amyloid beta (A4) precursor protein (App), transcript variant 3

USD 721.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name App (NM_001198824) Mouse Untagged Clone
Symbol App
Synonyms Abeta; Abpp; Adap; Ag; betaApp; Cvap; E030013M08Rik
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC228854 representing NM_001198824
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGCCCAGCTTGGCACTGCTCCTGCTGGCCGCCTGGACGGTTCGGGCTCTGGAGGTACCCACTGATG
GCAACGCCGGGCTGCTGGCAGAACCCCAGATCGCCATGTTCTGTGGTAAACTCAACATGCACATGAATGT
GCAGAATGGAAAGTGGGAGTCAGACCCGTCAGGGACCAAAACCTGCATTGGCACCAAGGAGGGCATCTTG
CAGTACTGCCAAGAGGTCTACCCTGAACTGCAGATCACAAACGTGGTGGAAGCCAACCAGCCAGTGACCA
TCCAGAACTGGTGCAAGCGGGGCCGCAAGCAGTGCAAGACACACACCCACATCGTGATTCCTTACCGTTG
CCTAGTTGGTGAGTTTGTGAGCGACGCCCTTCTCGTGCCCGACAAGTGCAAGTTCCTACACCAGGAGCGG
ATGGATGTTTGTGAGACCCATCTTCACTGGCACACCGTCGCCAAAGAGACATGCAGCGAGAAGAGCACTA
ACTTGCACGACTATGGCATGCTGCTGCCCTGCGGCATCGACAAGTTCCGAGGGGTAGAGTTTGTATGCTG
CCCGTTGGCCGAGGAAAGCGACAGCGTGGATTCTGCGGATGCAGAGGAGGATGACTCTGATGTCTGGTGG
GGTGGAGCGGACACAGACTACGCTGATGGCGGTGAAGACAAAGTAGTAGAAGTCGCCGAAGAGGAGGAAG
TGGCTGATGTTGAGGAAGAGGAAGCTGATGATGATGAGGATGTGGAGGATGGGGACGAGGTGGAGGAGGA
GGCCGAGGAGCCCTACGAAGAGGCCACCGAGAGAACAACCAGCACTGCCACCACCACCACAACCACCACT
GAGTCCGTGGAGGAGGTGGTCCGAGAGGTGTGCTCTGAACAAGCCGAGACCGGGCCATGCCGCGCAATGA
TCTCCCGCTGGTACTTTGATGTCACTGAAGGGAAGTGTGTCCCATTCTTTTACGGCGGATGTGGCGGCAA
CAGGAACAACTTTGACACGGAAGAGTACTGCATGGCGGTGTGTGGCAGCGTGTTTCCCACGACAGCAGCC
AGCACCCCCGACGCCGTCGACAAGTACCTGGAGACACCCGGGGACGAGAACGAGCATGCCCATTTCCAGA
AAGCCAAAGAGAGGCTGGAAGCCAAGCACCGAGAGAGAATGTCCCAGGTCATGAGAGAATGGGAAGAGGC
AGAGCGTCAAGCCAAGAACTTGCCCAAAGCTGACAAGAAGGCCGTTATCCAGCATTTCCAGGAGAAAGTG
GAATCTCTGGAACAGGAAGCAGCCAATGAGAGACAGCAGCTTGTAGAGACACACATGGCCAGAGTTGAAG
CCATGCTCAATGACCGCCGCCGCCTGGCCCTCGAGAATTACATCACTGCACTGCAGGCGGTGCCCCCAAG
GCCTCATCATGTGTTCAACATGCTGAAGAAGTACGTCCGTGCGGAGCAGAAAGACAGACAGCACACCCTA
AAGCATTTTGAACATGTGCGCATGGTGGACCCCAAGAAAGCTGCTCAGATCCGGTCCCAGGTTATGACAC
ACCTCCGTGTGATCTACGAGCGCATGAACCAGTCTCTGTCCCTGCTCTACAATGTCCCTGCGGTGGCTGA
GGAGATTCAAGATGAAGTCGATGAGCTGCTTCAGAAGGAGCAGAACTACTCCGACGATGTCTTGGCCAAC
ATGATCAGTGAGCCCAGAATCAGCTACGGAAACGACGCTCTCATGCCTTCGCTGACGGAAACCAAGACCA
CCGTGGAGCTCCTTCCCGTGAATGGGGAATTCAGCCTGGATGACCTCCAGCCGTGGCACCCTTTTGGGGT
GGACTCTGTGCCAGCCAATACCGAAAATGAAGTCGAGCCTGTTGACGCCCGCCCCGCTGCTGACCGAGGA
CTGACCACTCGACCAGGTTCTGGGCTGACAAACATCAAGACGGAAGAGATCTCGGAAGTGAAGATGGATG
CAGAATTCGGACATGATTCAGGATTTGAAGTCCGCCATCAAAAACTGGTGTTCTTTGCTGAAGATGTGGG
TTCGAACAAAGGCGCCATCATCGGACTCATGGTGGGCGGCGTTGTCATAGCAACCGTGATTGTCATCACC
CTGGTGATGTTGAAGAAGAAACAGTACACATCCATCCATCATGGCGTGGTGGAGGTCGACGCCGCCGTGA
CCCCAGAGGAGCGCCATCTCTCCAAGATGCAGCAGAACGGATATGAGAATCCAACTTACAAGTTCTTTGA
GCAAATGCAGAACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001198824
ORF Size 2256 bp
Insert Size 2256
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001198824.1, NP_001185753
RefSeq Size 3320
RefSeq ORF 2256
Locus ID 11820
Cytogenetics 16 C3.3|16 46.92 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.