Prkcg (NM_001291434) Mouse Untagged Clone

CAT#: MC228569

Prkcg (untagged) - Mouse protein kinase C, gamma (Prkcg), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Prkcg
• Synonyms: Pkcc; PKCgamma; Prkcc
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC228569 representing NM_001291434
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGGGTCTGGGCCCTGGCGGAGGCGACTCAGAGGGGGGACCCCGACCCCTGTTTTGCAGAAAGGGGG
  CGCTGAGGCAGAAGGTGGTCCACGAGGTGAAGAGCCACAAGTTCACCGCTCGTTTCTTCAAGCAGCCAAC
  CTTCTGCAGTCACTGTACCGACTTCATCTGGGGCATTGGAAAGCAGGGCCTGCAATGTCAAGTCTGTAGC
  TTTGTGGTTCACCGCCGATGCCACGAATTTGTGACCTTCGAGTGTCCAGGCGCTGGAAAGGGCCCCCAGA
  CGGACGACCCTCGCAACAAGCACAAGTTCCGTCTGCACAGCTACAGCAGTCCCACCTTCTGCGACCACTG
  TGGCTCCCTCCTTTACGGGCTGGTGCACCAGGGCATGAAATGTTCCTGTTGCGAGATGAATGTGCACCGG
  CGCTGTGTGCGCAGCGTGCCCTCCCTTTGCGGTGTGGACCACACAGAGCGCCGTGGACGTCTGCAACTGG
  AAATCCGGGCTCCTACGTCGGATGAGATCCATATTACTGTTGGCGAGGCCCGGAACCTCATTCCTATGGA
  CCCCAATGGCCTGTCTGATCCCTACGTGAAACTGAAGCTGATCCCGGACCCTCGGAACCTGACAAAACAG
  AAGACAAAGACCGTGAAAGCCACACTGAATCCCGTGTGGAACGAGACCTTCGTGTTCAACCTGAAGCCAG
  GGGATGTAGAGCGCCGGCTCAGTGTGGAGGTGTGGGATTGGGATAGGACATCCCGAAATGACTTCATGGG
  TGCCATGTCCTTTGGTGTCTCAGAGCTACTCAAGGCCCCTGTGGATGGATGGTACAAGTTACTGAACCAG
  GAGGAGGGCGAATATTACAATGTACCGGTGGCCGATGCTGACAACTGCAGCCTCCTCCAGAAGTTTGAGG
  CCTGCAATTACCCCTTGGAATTGTATGAGGTAATGCTGGCAGAGCGCAGAGGCTCCGACGAACTCTATGC
  CATCAAGATACTGAAGAAAGACGTCATCGTCCAGGATGACGATGTAGACTGCACCCTCGTAGAGAAGCGT
  GTCCTGGCATTGGGAGGCCGAGGTCCTGGAGGCCGGCCACACTTTCTCACGCAGCTTCACTCCACCTTTC
  AGACTCCGGACCGCCTGTATTTTGTGATGGAGTATGTCACTGGGGGCGATTTAATGTACCACATCCAGCA
  ACTGGGCAAGTTTAAGGAGCCTCATGCAGCATTCTACGCTGCGGAAATCGCCATAGGCCTCTTCTTCCTT
  CACAACCAGGGCATCATCTACAGGGACCTCAAGTTGGATAATGTGATGCTGGATGCTGAAGGACACATCA
  AGATCACAGACTTTGGCATGTGTAAAGAGAATGTCTTCCCTGGGTCCACAACCCGCACCTTCTGTGGCAC
  CCCAGACTACATAGCACCTGAGATCATTGCCTATCAGCCCTACGGGAAGTCTGTCGACTGGTGGTCTTTT
  GGGGTCCTGCTGTATGAGATGTTGGCAGGACAGCCACCCTTTGATGGGGAAGATGAGGAAGAGTTGTTTC
  AAGCCATCATGGAACAAACTGTCACCTATCCCAAGTCACTTTCCCGGGAAGCTGTGGCCATCTGCAAAGG
  GTTCCTGACCAAGCACCCAGGAAAACGCCTGGGCTCAGGGCCAGATGGGGAACCCACCATCCGGGCTCAT
  GGCTTTTTCCGTTGGATCGATTGGGAGAGGTTGGAGAGACTGGAAATTGCACCTCCTTTCAGACCACGTC
  CGTGTGGCCGCAGTGGCGAAAACTTTGACAAGTTCTTCACGCGGGCAGCGCCAGCACTGACCCCGCCAGA
  CCGCTTGGTTCTAGCCAGCATCGACCAAGCTGATTTCCAGGGCTTTACTTATGTGAACCCGGACTTCGTG
  CACCCAGATGCCCGCAGCCCCACAAGCCCTGTGCCCGTGCCTGTCATGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291434
• Insert Size: 1941 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291434.1, NP_001278363.1
• RefSeq Size: 2978 bp
• RefSeq ORF: 1941 bp
• Locus ID: 18752
• Cytogenetics: 7 1.93 cM
• Gene Summary: Calcium-activated, phospholipid- and diacylglycerol (DAG)-dependent serine/threonine-protein kinase that plays diverse roles in neuronal cells and eye tissues, such as regulation of the neuronal receptors GRIA4/GLUR4 and GRIN1/NMDAR1, modulation of receptors and neuronal functions related to sensitivity to opiates, pain and alcohol, mediation of synaptic function and cell survival after ischemia, and inhibition of gap junction activity after oxidative stress. Binds and phosphorylates GRIA4/GLUR4 glutamate receptor and regulates its function by increasing plasma membrane-associated GRIA4 expression. In primary cerebellar neurons treated with the agonist 3,5-dihyidroxyphenylglycine, functions downstream of the metabotropic glutamate receptor GRM5/MGLUR5 and phosphorylates GRIN1/NMDAR1 receptor which plays a key role in synaptic plasticity, synaptogenesis, excitotoxicity, memory acquisition and learning. May be involved in the regulation of hippocampal long-term potentiation (LTP), but may be not necessary for the process of synaptic plasticity. May be involved in desensitization of mu-type opioid receptor-mediated G-protein activation in the spinal cord, and may be critical for the development and/or maintenance of morphine-induced reinforcing effects in the limbic forebrain. May modulate the functionality of mu-type-opioid receptors by participating in a signaling pathway which leads to the phosphorylation and degradation of opioid receptors. May also contribute to chronic morphine-induced changes in nociceptive processing. Plays a role in neuropathic pain mechanisms and contributes to the maintenance of the allodynia pain produced by peripheral inflammation. Plays an important role in initial sensitivity and tolerance to ethanol, by mediating the behavioral effects of ethanol as well as the effects of this drug on the GABA(A) receptors. During and after cerebral ischemia modulate neurotransmission and cell survival in synaptic membranes, and is involved in insulin-induced inhibition of necrosis, an important mechanism for minimizing ischemic injury. Required for the elimination of multiple climbing fibers during innervation of Purkinje cells in developing cerebellum. Is activated in lens epithelial cells upon hydrogen peroxide treatment, and phosphorylates connexin-43 (GJA1/CX43), resulting in disassembly of GJA1 gap junction plaques and inhibition of gap junction activity which could provide a protective effect against oxidative stress. Phosphorylates p53/TP53 and promotes p53/TP53-dependent apoptosis in response to DNA damage. Involved in the phase resetting of the cerebral cortex circadian clock during temporally restricted feeding. Stabilizes the core clock component ARNTL/BMAL1 by interfering with its ubiquitination, thus suppressing its degradation, resulting in phase resetting of the cerebral cortex clock (PubMed:23185022).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.