Elf2 (NM_001291062) Mouse Untagged Clone

CAT#: MC228145

Elf2 (untagged) - Mouse E74-like factor 2 (Elf2), transcript variant 3

USD 495.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Elf2 (NM_001291062) Mouse Untagged Clone
Symbol Elf2
Synonyms 2610036A20Rik; A230104O07Rik; AW111824; BB183398; EU32; NERF; NERF-1A; NERF-1B; NERF-2
Vector pCMV6-Entry
Sequence Data
>MC228145 representing NM_001291062
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGACGTCTCTGCATGAGGGACCCACGAACCAGCTGGATCTGCTCATCCGGGCCGTGGAAGCATCAG
TTCACAGCAGTAATGCTCACTGTACGGATAAGACCATTGAAGCTGCTGAAGCCCTGCTTCATATGGAATC
TCCTACCTGCTTGAGGGATTCAAGAAGTCCTGAGTTTATCCATGCTGCGATGAGGCCGGATGTCATCACA
GAGACTGTAGTGGAGGTGTCCACAGAAGAGTCTGAGCCGATGGATGCCTCGCCTATCCCTACTTCACCAG
ACAGCCACGAACCAATGAAAAAGAAAAAAGTTGGCCGTAAACCAAAGACCCAGCAGTCACCAGTTTCCAA
TGGGTCTCCTGAGTTAGGAATCAAGAAGAAAGCCAGAGAAGGAAAAGGAAACACAACCTATCTGTGGGAG
TTTCTTTTAGATTTGCTTCAAGATAAAAATACTTGTCCCAGGTATATTAAATGGACTCAGAGAGAAAAGG
GCATATTCAAACTTGTGGACTCAAAGGCTGTCTCGAAGCTCTGGGGGAAGCATAAGAACAAACCAGATAT
GAACTATGAAACCATGGGGCGAGCGTTAAGATATTACTACCAAAGGGGAATTCTTGCAAAGGTTGAAGGA
CAGAGGCTTGTATATCAGTTCAAGGACATGCCCAAAAACATAGTGGTCATTGATGATGACAAAAGTGAGA
CCTGCCCTGAAGACTTGGCAGCAGCTGCTGATGACAAGTCTTTAGAACGAGTGTCACTATCTGCAGAAAG
TCTCCTGAAGGCAGCAACTGCCGTCCGAGGTGGGAAAAACTCATCTCCTCTGAACTGCTCCAGAGCAGAG
AAGGGTGTGGCTAGAGTTGTGAACATCACCTCCCCTACTCACGACGGTTCCTCCAGGTCTCCTACTACCA
CTGCACCTGTGTCAGCAGCAGCAGCTCCAAGGACAGTTCGTGTGGCAATGCAAGTCCCTGTGGTAATGAC
CTCACTGGGCCAAAAGATTTCAGCGGTGGCAGTTCAGTCAGTCAATGCAGGCACAGGCTCGCCGTTAATA
ACCAGCACCAGTCCAGCCTCGGCCAGCTCTCCAAAAGTAGTCATCCAGACAGTCCCGACCGTGATGCCGG
CCTCCACTGAAAATGGAGACAGAATCACCATGCAGCCTGCCAAGATTATCACCATCCCCGCCACCCAGCT
CGCACAGTGTCAACTCCAGGCAAAGTCAAACCTGACGGGGTCAGGAAGCATTAACATTGTTGGAACCCCA
CTGGCTGTGAGGGCACTCACCCCTGTTTCAATAGCCCACGGTACACCTGTAATGAGACTGTCTGTGCCTG
CTCAGCAGGCTTCTGGCCAGACTCCTCCTCGAGTTATCAGTGCGCTCCTAAAAGGGCCGGAGGGGAAATC
AGAAGCCAAAAAGCAGGAACACGATGTGAAAACTTTGCAGCTGGTAGAAGAGAAGGGGGCAGACGGCAAT
AAGACAGTAACCCACGTAGTGGTCGTCAGTGCGCCGTCTGCTATCGCCCTTCCTGTGACTATGAAAACCG
AAGGGCTAGTGACGTGTGAGAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001291062
ORF Size 1566 bp
Insert Size 1566
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001291062.1, NP_001277991
RefSeq Size 5459
RefSeq ORF 1566
Locus ID 69257
Cytogenetics 3|3 C
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.