Rnpc3 (NM_001038696) Mouse Untagged Clone

CAT#: MC228120

Rnpc3 (untagged) - Mouse RNA-binding region (RNP1, RRM) containing 3 (Rnpc3), transcript variant 1

USD 485.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Rnpc3 (NM_001038696) Mouse Untagged Clone
Symbol Rnpc3
Synonyms 2810441O16Rik; AI447568; C030014B17Rik
Vector pCMV6-Entry
Sequence Data
>MC228120 representing NM_001038696
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGGGCCTGAGCCGCCGATGCCGCTGTCCCGAGGCGGCCCAGGCTCCGCTTCGCTTTCTCCGCCCC
GGGGAGACCGCACCCTCCTCGTCAGGCACCTGCCGGCCGAGCTGACGGCTGAGGAGAAGGAGGACTTACT
GAAGTACTTCGGGGCGCAGTCGGTGCGCGTCCTGTCAGATAAGGGGCGCCTGAAACACACAGCATTTGCT
ACTTTCCCTAATGAAAAAGCAGCAATAAAGGCACTGACGAGACTCCATCAGCTGAAACTTCTAGGTCATA
CTTTAGTTGTTGAATTTGCAAAAGAGCAAGATCGAGTTCACTCCCCATGTTCCACCTCAAATACAGAGAA
AAAGAAAAGGTTGGATGACACTGTGGAAAATGATAAAGAGAAGAAAGAACCTGACATTTTAACAGTAGAA
AATGGAATTGCACCAAATCATGGGCTGACTTTTCCTCTGAATTCATGCCTTAAATATATGTATCCTCCAC
CATCAAGCACAATCCTCGCAAATATAGTAAATGCTCTGGCAAGTGTCCCAAAATTCTATGTACAGGTGCT
TCATCTTATGAATAAAATGAATTTGCCCACACCATTTGGACCGATTACTGCACGACCTCCTATGTATGAG
GACTATATGCCATTGCATGCACCCCTTCCACCTACATCCCCTCAACCGCCTGAGGAGCCTCCCTTACCAG
ATGAGGATGAGGATTTATCTAGCAAAGAATCAGAATATGAAAGCAGTGATGAGGAGGACCGACAGAGAAT
GAACAGATTAATGGAACTAGCAAATCTTCAGCCCAAAAGACCCAAAACAGAAAAGCCACGCCACGTGAGA
AAAAAGCGAAAAATAAAGGATATGTTGAATATACCTTCATCAGCTTCACATAGTTTGCATCCTGTGCTGT
TACCTTCGGATGTATTTGACCAGCCACAATCTGTAGGTAATAAAAAAATTGAGTTCAATATATCAACCAA
CATGCCTGCAGCATTTAACAAAGATTTGGAGACACAACCAAATAATGAAGAAGAAAATTCTGATTCACCA
GACACTGGACTTGATTCAAATACAGGATTTGGCAAAATCTTCCCTAAACCTAATTTGAACATCACAGAAG
AGATTACAGAAGACTCTGATGAAATACCTTCACAATTTATTTCTAGAAAAGAGTTGGAAAAGGGTCGTAT
TTCTAGAGAAGAAATGGAAACACTTTCAGTTTTTAGAAGTTATGAACCTGGTGAACCAAACTGCAGAATT
TATGTAAAGAATTTAGCTAGACATGTTCAGGAAAAGGACCTTAAATTTATATTTGGAAGATACGTTGACT
TTTCTTCAGAAACACAGCGGATCATGTTTGATATTCGCTTAATGAAAGAAGGACGCATGAAAGGACAAGC
TTTTGTTGGACTTCCAAATGAAAAAGCAGCCGCTAAAGCGTTGAAAGAAGCTAATGGCTATGTTCTTTTT
GGAAAACCCATGGTGGTTCAGTTTGCTCGATCTGCTAGACCAAAACAGGATTCTAAAGAAGGAAAACGGA
AGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001038696
ORF Size 1545 bp
Insert Size 1545
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001038696.1, NP_001033785
RefSeq Size 3888
RefSeq ORF 1545
Locus ID 67225
Cytogenetics 3|3 F3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.