Camk2d (NM_001293663) Mouse Untagged Clone

CAT#: MC228110

Camk2d (untagged) - Mouse calcium/calmodulin-dependent protein kinase II, delta (Camk2d), transcript variant 4

USD 485.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Camk2d (NM_001293663) Mouse Untagged Clone
Symbol Camk2d
Synonyms 2810011D23Rik; 8030469K03Rik; CaMK II; [d]-CaMKII
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC228110 representing NM_001293663
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTTCGACCACCACCTGCACCCGGTTCACCGACGAGTATCAGCTCTTTGAGGAGCTCGGAAAGGGGG
CGTTCTCAGTGGTGAGAAGATGTATGAAAATCCCTACTGGACAAGAGTATGCTGCCAAAATTATCAACAC
CAAAAAGCTTTCTGCTAGGGACCATCAGAAACTGGAAAGGGAAGCTAGAATCTGCCGTCTCTTGAAGCAC
CCCAATATTGTGAGACTTCACGACAGTATATCGGAGGAGGGCTTCCATTACTTGGTGTTTGACTTAGTGA
CTGGTGGCGAACTGTTTGAAGACATAGTGGCAAGAGAATATTACAGTGAAGCTGATGCCAGTCATTGTAT
ACAACAGATTCTAGAGAGTGTAAATCATTGTCACCTAAATGGCATAGTTCACAGGGACCTGAAGCCTGAG
AATTTGCTTTTAGCTAGCAAGTCCAAAGGAGCAGCTGTGAAGCTGGCAGACTTCGGCTTAGCCATAGAAG
TTCAAGGCGACCAGCAGGCATGGTTTGGTTTTGCTGGCACACCTGGGTATCTTTCTCCAGAAGTCCTGCG
TAAAGATCCTTATGGAAAACCAGTGGATATGTGGGCATGCGGTGTCATCCTCTACATCTTGCTGGTGGGA
TACCCACCCTTCTGGGATGAAGATCAGCATAGACTGTATCAGCAGATCAAGGCCGGAGCTTACGATTTTC
CGTCACCAGAATGGGATACAGTGACACCTGAAGCCAAAGACCTCATCAACAAAATGCTGACCATCAACCC
TGCCAAACGTATCACAGCCTCTGAGGCCCTGAAACACCCATGGATCTGTCAACGCTCTACTGTTGCCTCC
ATGATGCACAGGCAGGAGACTGTAGACTGCTTGAAGAAATTTAATGCTAGACGGAAACTGAAGGGCGCCA
TCTTGACAACTATGCTGGCTACGAGAAATTTTTCAGCAGCCAAGAGTTTATTGAAGAAACCAGATGGGGT
AAAGATAAACAACAAAGCCAACGTGGTAACCAGCCCCAAAGAAAATATTCCTACCCCGGCGCTGGAGCCC
CAAACTACTGTAATCCACAACCCTGACGGAAACAAGGAGTCAACTGAGAGCTCAAACACCACCATTGAGG
ATGAAGACGTGAAAGCACGAAAACAGGAGATCATCAAAGTCACTGAGCAACTGATTGAAGCTATCAACAA
TGGGGACTTTGAGGCTTACACAAAAATCTGTGATCCAGGCCTCACTGCCTTTGAACCTGAAGCATTGGGC
AACTTAGTGGAAGGGATGGACTTTCACAGATTCTACTTTGAAAATGCTTTGTCCAAAAGCAATAAACCAA
TCCACACGATCATCCTCAACCCACACGTTCACCTGGTAGGGGATGACGCAGCCTGCATCGCATACATTCG
GCTCACACAGTACATGGACGGAAGCGGGATGCCAAAGACCATGCAGTCAGAAGAGACGCGCGTGTGGCAC
CGCCGTGATGGGAAGTGGCAGAATGTTCACTTTCACCGTTCGGGGTCCCCCACAGTACCCATCAACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001293663
ORF Size 1539 bp
Insert Size 1539
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001293663.1, NP_001280592
RefSeq Size 5615
RefSeq ORF 1539
Locus ID 108058
Cytogenetics 3|3 G1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.