Fbxw27 (NM_001303003) Mouse Untagged Clone

CAT#: MC227842

Fbxw27 (untagged) - Mouse F-box and WD-40 domain protein 27 (Fbxw27), transcript variant 1

USD 443.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Fbxw27 (NM_001303003) Mouse Untagged Clone
Symbol Fbxw27
Synonyms 1700124P09Rik
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC227842 representing NM_001303003
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGACCCATTTGCCTAGTTTGCCGTTGATGAAAATCTTCTCCTATCTGGATGCCTACAGTTTGCTAC
AGGTTGCCCAAGTGAACAAGAACTGGAATGCACTTGCAAGCAGTGATGTCCTGTGGAGGAAGTTGTGTCA
GAAGAGATGGCTTTTCTGTGACATGGTCACCCTACAGCTCCAGGACAAAGAGACATGGAAGCAGTTCTTC
GTTTACCGAACGTGGCAAGAACACTCCAAGACCCGGGCAAATCCACGAGATTTCACTTACAAGGAAATTC
CTTTGCAATATGGACCTTGTGGCTATGCATGTTATATCTCAGGGTGTGGCATAACAAGAAAGGGACAAGA
CAAGTCTGTTGTCTGTATGGTGAATTCCAAGAACACGATTTCCACCTGGGATGTTCACAAGAGCGTTATA
ACCTGGGTAAGCCCAGAACAGCCGGCAAGTATCAAGCTGTTGACTACCCTCCCTGAGATGCACATTGCAG
TCACTGTAGATATTCAATCAACTATCAAACTGTGGGACTGTCACAACAGGGAAGCTCTGGCGACTAACAT
CCTGGAATCTCCATGCAAATCACTGAAAGCTGTCATTACCAAGGATGACCCGATTGTCTTGGCAGGCGAT
ATCTTGGGTAACCTGTACATCTTTAGAATTCCAGATTTACACCTCATTTCCACAGTCAATGTATTGCCAT
GTGATATTGATGAAATCTACTGCTCTCCTCAGAAGAAATGGGTCTTACTGAGTAAGAAACAGCCATATAT
TTTGCCAAAGGTGTTTTACATGAGCAGCCTACTGAGGACATCAGAATTCTCTGCCCCTGTGTCTACCCTT
CTGGAAATTTCCTTATGTCAAGAAGCCTTCTGGACCCCAAGAAGGGAAGACAGGCTAACCCTGATGTCCA
GAAGTGGTTGCTCCAAAATCACAAAGTTTGAAACATATGATATGAAGCTGGAAGAGTTTGGGAACAAAAT
TATTGTTAAAGGAAATTCGATAGCAGGCTTTTTGTTGCCATATTACACGGAAAGCCTGAACTGGTTTGGA
GTCAGTGATAAGGACACGATTGTTTGTTCAACTGAATTCTCTCTCTTGCTCTTTACCAATAATGGTCACC
GTCTGCAGACCTTTCAGTACTTCTCAGAAACGATCGTGAGACTCTCTGTGGACCCCGTTCATGTCATCGT
CACCTGTAATGATGGCTCTTTGGATGTATATGCATGGGAGGAGAGAAGCCTGCTGCTCAGGAAGTGTTAT
CGACTGAAAAACAGGAGACATCTGTCACCGAGAGGCTTCATTAACAAAACGCTATGTGATGATGTGAGCA
TAATTCAGTTGATGATAGATGGTCATGACACCTGGTTTCTGATGGCATATGCCTTGAATATCTGCTCTTG
A


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001303003
ORF Size 1401 bp
Insert Size 1401
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001303003.1, NP_001289932
RefSeq Size 1497
RefSeq ORF 1401
Locus ID 76998
Cytogenetics 9|9 F2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.