Erg (NM_001302152) Mouse Untagged Clone

CAT#: MC227823

Erg (untagged) - Mouse avian erythroblastosis virus E-26 (v-ets) oncogene related (Erg), transcript variant 2

  View "NM_001302152" in other vectors (1)

USD 460.00


Availability*
2 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Erg (NM_001302152) Mouse Untagged Clone
Symbol Erg
Synonyms D030036I24Rik
Vector pCMV6-Entry
Sequence Data
>MC227823 representing NM_001302152
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATCCAGACTGTACCTGACCCAGCAGCTCATATTAAGGAGGCCTTGTCAGTTGTGAGCGAGGACCAGT
CACTATTTGAGTGTGCCTACGGAACGCCACACCTGGCTAAGACAGAGATGACCGCATCCTCTTCCAGTGA
CTATGGCCAGACATCCAAGATGAGTCCCAGAGTCCCTCAGCAGGACTGGCTGTCTCAAGCCCCAGCCAGG
GTCACCATCAAGATGGAGTGCAACCCTAGTCAGGTGAATGGTTCCAGGAACTCACCTGATGAGTGCAGTG
TGAACAAAGGTGGGAAGATGGTGGGCAGCCCGGATACTGTGGGGATGAGCTACGGCAGCTACATGGAGGA
GAAGCATGTGCCGCCTCCCAATATGACCACAAATGAGCGCAGAGTGATCGTCCCTGCAGATCCTACTCTG
TGGAGCACAGACCATGTCCGACAGTGGCTGGAGTGGGCGGTGAAAGAATATGGCCTCCTCGATGTGGACG
TCTTACTATTTCAGAATATCGATGGGAAGGAGCTGTGCAAGATGACAAAGGATGACTTCCAGCGGCTCAC
GCCGAGCTACAATGCCGACATTCTTCTCTCACATCTCCACTACCTCAGAGAGACTCCCCTTCCACATCTG
ACTTCCGATGACGTTGATAAGGCTTTACAAAACTCTCCACGGTTAATGCATGCCAGAAACACAGATTTAC
CTTATGAGCCTCCCAGGAGATCAGCCTGGACCGGCCACAGCCACCTCACCCCTCAGTCCAAAGCTGCTCA
GCCATCTCCCTCTGCAGTGCCCAAAACTGAAGACCAGCGTCCTCAGTTAGATCCTTACCAGATCCTGGGA
CCGACCAGTAGCCGCCTTGCTAATCCAGGTAGTGGCCAGATCCAGCTGTGGCAGTTCCTGCTCGAACTCC
TGTCAGACAGCTCCAACTCCAACTGCATCACCTGGGAAGGCACCAACGGGGAGTTCAAGATGACAGACCC
GGACGAGGTGGCTCGGCGCTGGGGGGAGAGGAAGAGCAAGCCCAACATGAACTATGACAAGCTCAGCCGC
GCCCTCCGCTACTACTACGACAAAAACATCATGACCAAGGTGCACGGGAAGCGCTACGCCTACAAGTTTG
ACTTCCACGGGATTGCCCAGGCCCTGCAGCCCCACCCTCCTGAGTCGTCCCTGTACAAGTACCCCTCCGA
CCTGCCATACATGGGCTCCTATCACGCCCACCCCCAGAAGATGAACTTTGTGTCTCCCCACCCTCCCGCT
CTCCCAGTCACATCTTCCAGTTTCTTTGCTTCCCCGAACCCATACTGGAATTCACCGACTGGGGGCATCT
ACCCGAACACTAGGCTCCCAGCCAGCCATATGCCCTCTCACCTGGGCACCTACTACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001302152
ORF Size 1389 bp
Insert Size 1389
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001302152.1, NP_001289081
RefSeq Size 3283
RefSeq ORF 1389
Locus ID 13876
Cytogenetics 16 C4|16 56.04 cM
Gene Summary Transcriptional regulator. May participate in transcriptional regulation through the recruitment of SETDB1 histone methyltransferase and subsequent modification of local chromatin structure. [UniProtKB/Swiss-Prot Function]

Other Versions

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies