Nr1h2 (NM_001285518) Mouse Untagged Clone

CAT#: MC227728

Nr1h2 (untagged) - Mouse nuclear receptor subfamily 1, group H, member 2 (Nr1h2), transcript variant 3


  "NM_001285518" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Nr1h2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Nr1h2
Synonyms AI194859; LXR; LXRB; LXRbeta; LXRBSV; NER1; OR-1; RIP15; Unr; Unr2; UR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227728 representing NM_001285518
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTTCCCCCACAAGTTCTCTGGACACTCCCGTGCCTGGGAATGGTTCTCCTCAGCCCAGTACCTCCG
CCACGTCACCCACTATTAAGGAAGAGGGGCAGGAGACTGATCCTCCTCCAGGCTCTGAAGGGTCCAGCTC
TGCCTACATCGTGGAGCCAGAGGATGAGCCTGAGCGCAAGCGGAAGAAGGGGCCGGCCCCGAAGATGCTG
GGCCATGAGCTGTGCCGCGTGTGCGGAGACAAGGCTTCGGGCTTCCACTACAACGTGCTCAGCTGTGAAG
GCTGCAAAGGCTTCTTCCGGCGCAGTGTGGTCCACGGTGGGGCCGGGCGCTATGCCTGTCGGGGCAGCGG
AACCTGCCAGATGGATGCCTTCATGCGGCGCAAGTGCCAGCTCTGCCGGCTGCGCAAGTGCAAGGAGGCT
GGCATGCGGGAGCAGTGCGTGCTCTCTGAGGAGCAGATTCGGAAGAAAAGGATTCAGAAGCAGCAACAGC
AGCAGCCACCACCCCCATCTGAGCCAGCAGCCAGCAGCTCAGGCCGGCCAGCGGCCTCCCCTGGCACTTC
GGAAGCAAGCAGCCAGGGCTCCGGGGAAGGAGAGGGCATCCAGCTGACCGCGGCTCAGGAGCTGATGATC
CAGCAGTTAGTTGCCGCGCAGCTGCAGTGCAACAAACGATCTTTCTCCGACCAGCCCAAAGTCACGCCCT
GGCCCCTGGGTGCAGACCCTCAGTCCCGAGATGCCCGTCAGCAACGCTTTGCCCACTTCACCGAGCTAGC
CATCATCTCGGTCCAGGAGATTGTGGACTTTGCCAAGCAGGTGCCAGGGTTCTTGCAGTTGGGCCGGGAG
GACCAGATCGCCCTCCTGAAGGCGTCCACCATTGAGATCATGTTGCTAGAAACAGCCAGACGCTACAACC
ACGAGACAGAATGCATCACGTTCCTGAAGGACTTCACCTACAGCAAGGACGACTTCCACCGTGCAGGCTT
GCAGGTGGAATTCATCAATCCCATCTTCGAGTTCTCGCGGGCCATGCGGCGGCTGGGCCTGGACGATGCA
GAGTATGCCTTGCTTATCGCCATCAACATCTTCTCAGCCGATCGGCCTAATGTGCAGGAGCCCAGCCGTG
TGGAGGCCCTGCAGCAGCCCTACGTGGAGGCGCTCCTCTCCTACACGAGGATCAAGCGCCCACAGGACCA
GCTCCGCTTCCCACGCATGCTCATGAAGCTGGTGAGCCTGCGCACCCTCAGCTCCGTGCACTCGGAGCAG
GTCTTTGCATTGCGACTCCAGGACAAGAAGCTGCCGCCCTTGCTGTCCGAGATCTGGGATGTGCACGAGT
AG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001285518
Insert Size 1332 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001285518.1, NP_001272447.1
RefSeq Size 2016 bp
RefSeq ORF 1332 bp
Locus ID 22260
UniProt ID Q60644
Cytogenetics 7 B3
Gene Summary Nuclear receptor that exhibits a ligand-dependent transcriptional activation activity (PubMed:18055760, PubMed:19520913, PubMed:20427281). Binds preferentially to double-stranded oligonucleotide direct repeats having the consensus half-site sequence 5'-AGGTCA-3' and 4-nt spacing (DR-4) (PubMed:18055760, PubMed:19520913, PubMed:20427281). Regulates cholesterol uptake through MYLIP-dependent ubiquitination of LDLR, VLDLR and LRP8; DLDLR and LRP8 (PubMed:18055760, PubMed:19520913, PubMed:20427281). Interplays functionally with RORA for the regulation of genes involved in liver metabolism (PubMed:18055760, PubMed:19520913, PubMed:20427281). Plays an anti-inflammatory role during the hepatic acute phase response by acting as a corepressor: inhibits the hepatic acute phase response by preventing dissociation of the N-Cor corepressor complex (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Variants 3 and 4 both encode the same isoform (b).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.