Pax6 (NM_001244201) Mouse Untagged Clone

CAT#: MC227620

Pax6 (untagged) - Mouse paired box 6 (Pax6), transcript variant 4


  "NM_001244201" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Goat Polyclonal Antibody against PAX6
    • 100 ug

USD 520.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Pax6"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pax6
Synonyms 1500038E17Rik; AEY1; AEY11; Dey; Gsfaey; Gsfaey11; Pax; Pax-6; Sey
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227620 representing NM_001244201
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGAACAGTCACAGCGGAGTGAATCAGCTTGGTGGTGTCTTTGTCAACGGGCGGCCACTGCCGGACT
CCACCCGGCAGAAGATCGTAGAGCTAGCTCACAGCGGGGCCCGGCCGTGCGACATTTCCCGAATTCTGCA
GGTATCCAACGGTTGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGACCCAGGGCA
ATCGGAGGGAGTAAGCCAAGAGTGGCGACTCCAGAAGTTGTAAGCAAAATAGCCCAGTATAAACGGGAGT
GCCCTTCCATCTTTGCTTGGGAAATCCGAGACAGATTATTATCCGAGGGGGTCTGTACCAACGATAACAT
ACCCAGTGTGTCATCAATAAACAGAGTTCTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCAGAC
GGCATGTATGATAAACTAAGGATGTTGAACGGGCAGACCGGAAGCTGGGGCACACGCCCTGGTTGGTATC
CCGGGACTTCAGTACCAGGGCAACCCACGCAAGATGGCTGCCAGCAACAGGAAGGAGGGGGAGAGAACAC
CAACTCCATCAGTTCTAACGGAGAAGACTCGGATGAAGCTCAGATGCGACTTCAGCTGAAGCGGAAGCTG
CAAAGAAATAGAACATCTTTTACCCAAGAGCAGATTGAGGCTCTGGAGAAAGAGTTTGAGAGGACCCATT
ATCCAGATGTGTTTGCCCGGGAAAGACTAGCAGCCAAAATAGATCTACCTGAAGCAAGAATACAGGTATG
GTTTTCTAATCGAAGGGCCAAATGGAGAAGAGAAGAGAAACTGAGGAACCAGAGAAGACAGGCCAGCAAC
ACTCCTAGTCACATTCCTATCAGCAGCAGCTTCAGTACCAGTGTCTACCAGCCAATCCCACAGCCCACCA
CACCTGTCTCCTCCTTCACATCAGGTTCCATGTTGGGCCGAACAGACACCGCCCTCACCAACACGTACAG
TGCTTTGCCACCCATGCCCAGCTTCACCATGGCAAACAACCTGCCTATGCAACCCCCAGTCCCCAGTCAG
ACCTCCTCATACTCGTGCATGCTGCCCACCAGCCCGTCAGTGAATGGGCGGAGTTATGATACCTACACCC
CTCCGCACATGCAAACACACATGAACAGTCAGCCCATGGGCACCTCGGGGACCACTTCAACAGGACTCAT
TTCACCTGGAGTGTCAGTTCCCGTCCAAGTTCCCGGGAGTGAACCTGACATGTCTCAGTACTGGCCTCGA
TTACAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001244201
Insert Size 1269 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001244201.2, NP_001231130.1
RefSeq Size 3609 bp
RefSeq ORF 1269 bp
Locus ID 18508
UniProt ID P63015
Cytogenetics 2 55.31 cM
Gene Summary This gene encodes a homeobox-containing protein that functions as a regulator of transcription. It plays a key role in the development of neural tissues, particularly the eye. Activity of this protein is also required for expression of glucagon in the pancreas. This gene is regulated by multiple enhancers located up to tens or hundreds of kilobases upstream and downstream of the transcription start sites. Mutations in this gene or deletion of these regulatory elements results in severe defects in eye development. Alternative splicing and the use of alternative promoters results in multiple transcript variants, some of which encode proteins that lack the N-terminal paired domain. [provided by RefSeq, Jul 2015]
Transcript Variant: This variant (4) lacks an in-frame exon in the 5' coding region compared to variant 1. It initiates from the P0 promoter. The encoded isoform (2) is shorter than isoform 1. Variants 4, 5, and 6 encode the same protein (isoform 2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.