Nxf1 (NM_001276704) Mouse Untagged Clone

CAT#: MC227594

Nxf1 (untagged) - Mouse nuclear RNA export factor 1 (Nxf1), transcript variant 2


  "NM_001276704" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Nxf1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Nxf1
Synonyms Mex67; Mvb1; Tap
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227594 representing NM_001276704
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGACGAAGGGAAGTCATACAACGAGCATGATGACCGTGTTAGTTTCCCTCAAAGAAGAAAGAAAG
GCCGGGGGCCTTTCCGATGGAAGTGTGGTGAGGGGAATCGTAGGTCTGGAAGAGGTGGTTCTGGTGTACA
GTCTTCCCGATTTGAGGAAGATGATGGCGATGTAGCAATGAATGATCCCCAGGATGGCCCCCGAGTAAGA
TACAATCCCTATACCAACCGGCCTAATCGTCGGGGAGATGGTTGGCATGATCGAGATCGAATTCATATTA
CTGTACGGAGAGACAGAGCTCCTGCAGAGAGAGGAGGGGCTGGCACCAGTCAAGATGGGACCACCAAGAA
CTGGTTCAAGATTACAATTCCTTATGGTAGAAAGTATGACAAAACGTGGCTTCTGAGCATGATTCAGAGC
AAATGCAGTGTCCCCTTCAATCCCATCGAGTTTCACTATGAAAATACACGGGCCCATTTTTTTGTGGAGG
ATGCCACTACTGCTTCTGCATTAAAGGGTGTCAACCATAAGATCCAGGATCGAGAAAACAGAAGGATATC
TATCATCATCAATGCTTCTGCTCCACCCTACACTGTACAGAATGAACTGAAGCCCGAACAAATAGAGCAG
CTCAAGCTGATCATGAGCAAACGATATGATGGCAACCAACAAGCACTTGACCTCAAGGGGCTCCGCTCAG
ACCCAGATTTGGTGGCCCAGAACATCGATGTTGTTCTAAACCGCAGAAGCTGTATGGCAGCCACCCTGCG
GATCATTGAAGAGAACATTCCTGAGCTATTGTCTTTGAACTTGAGCAGCAACAGGCTATACAAGCTGGAT
GATATGTCTAGCATTGTGCAGAAGGCGCCAAACCTAAAGACCCTAAATCTCTCCGGAAACGAATTGAAGA
CTGAGCGGGAATTAGACAAGATAAAAGGGCTGAAGCTGGAAGAGCTGTGGCTTGACAGAAACCCCATGTG
TGACAACTTCGGAGACCAGTCCAGCTATATCAGGTCAGTTGTAGCCTCTGTCTCCCCTCCTGGGGACATT
CACCCCTGGGAGGCTGAGCTCATGCACCCTGACCAGTGCCCGTCTACAGGAGAACATGCAGCCCTGAGCT
GGAACCACCTGTTCTTTGGGAGGAGGATCATGTATTCCTTTCTGCCTGTCTGTTGTCTCCTAGCTCTGTC
CCAGATCTCTTCTTTCTTCTCACCTGACTTCTGTTCTCTAGTTCTGGCCTTTCTCCTTCTTTCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001276704
Insert Size 1257 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001276704.1, NP_001263633.1
RefSeq Size 4035 bp
RefSeq ORF 1257 bp
Locus ID 53319
Cytogenetics 19 5.5 cM
Gene Summary Involved in the nuclear export of mRNA species bearing retroviral constitutive transport elements (CTE) and in the export of mRNA from the nucleus to the cytoplasm (TAP/NFX1 pathway). The NXF1-NXT1 heterodimer is involved in the export of HSP70 mRNA in conjunction with ALYREF/THOC4 and THOC5 components of the TREX complex. ALYREF/THOC4-bound mRNA is thought to be transferred to the NXF1-NXT1 heterodimer for export. Also involved in nuclear export of m6A-containing mRNAs: interaction between SRSF3 and YTHDC1 facilitates m6A-containing mRNA-binding to both SRSF3 and NXF1, promoting mRNA nuclear export.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains an alternate internal segment and transcription extends past a splice site that is used in variant 1. This results in a novel 3' coding region and 3' UTR, compared to variant 1. It encodes isoform 2 which is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.