Syt1 (NM_001252342) Mouse Untagged Clone

CAT#: MC227592

Syt1 (untagged) - Mouse synaptotagmin I (Syt1), transcript variant 3


  "NM_001252342" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Syt1 Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Syt1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Syt1
Synonyms AW124717; G630098F17Rik; SytI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227592 representing NM_001252342
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGAGTGCCAGTCGTCCTGAGGCCCTGGCTGCCCCTGTCACCACTGTTGCGACCCTTGTCCCACACA
ACGCCACTGAGCCAGCCAGTCCTGGGGAAGGGAAGGAAGATGCCTTTTCCAAGCTGAAGCAGAAGTTTAT
GAATGAACTGCATAAAATCCCATTGCCACCGTGGGCCTTAATTGCCATAGCCATAGTTGCGGTCCTTCTA
GTCGTGACCTGCTGCTTCTGTGTCTGTAAGAAATGTTTGTTCAAAAAGAAAAACAAGAAGAAGGGAAAGG
AAAAGGGAGGGAAGAACGCCATTAACATGAAAGACGTGAAAGACTTAGGGAAGACCATGAAGGATCAGGA
TGACGATGCTGAAACTGGACTGACTGATGGAGAAGAAAAGGAGGAGCCCAAGGAAGAGGAGAAACTGGGA
AAGCTTCAATATTCACTGGACTATGACTTCCAGAATAACCAGCTGCTGGTGGGAATCATCCAGGCTGCTG
AACTGCCCGCCCTGGACATGGGAGGCACATCTGATCCATACGTCAAAGTCTTCCTGCTGCCCGACAAAAA
GAAGAAGTTTGAGACAAAAGTCCACCGGAAAACCCTCAATCCAGTCTTCAATGAACAGTTTACTTTCAAG
GTGCCATACTCGGAATTAGGTGGCAAGACACTGGTGATGGCTGTGTATGATTTTGACCGCTTCTCCAAGC
ACGACATCATTGGAGAGTTCAAAGTTCCTATGAACACCGTGGATTTTGGCCACGTCACCGAGGAGTGGCG
CGATCTCCAGAGTGCTGAGAAAGAAGAGCAAGAGAAACTGGGTGACATCTGCTTCTCCCTCCGCTACGTC
CCTACTGCCGGCAAGCTGACTGTTGTCATTCTGGAAGCCAAGAACCTGAAGAAGATGGATGTGGGTGGCT
TATCTGATCCCTATGTAAAGATTCACCTGATGCAGAACGGCAAGAGACTGAAGAAGAAAAAGACAACGAT
TAAGAAGAACACACTTAACCCCTACTACAATGAGTCCTTCAGCTTTGAAGTTCCGTTCGAGCAAATCCAG
AAAGTGCAAGTGGTGGTAACTGTTTTGGACTATGACAAGATTGGCAAGAACGACGCCATCGGCAAAGTCT
TTGTGGGCTACAACAGCACCGGCGCAGAGCTGCGACACTGGTCAGACATGCTGGCCAACCCCCGGCGACC
CATCGCCCAGTGGCACACTCTGCAGGTAGAGGAGGAGGTTGATGCCATGCTGGCTGTCAAGAAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001252342
Insert Size 1257 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001252342.1, NP_001239271.1
RefSeq Size 4747 bp
RefSeq ORF 1257 bp
Locus ID 20979
UniProt ID P46096
Cytogenetics 10 56.52 cM
Gene Summary Calcium sensor that participates in triggering neurotransmitter release at the synapse (PubMed:11242035). May have a regulatory role in the membrane interactions during trafficking of synaptic vesicles at the active zone of the synapse (PubMed:7961887). It binds acidic phospholipids with a specificity that requires the presence of both an acidic head group and a diacyl backbone. A Ca(2+)-dependent interaction between synaptotagmin and putative receptors for activated protein kinase C has also been reported. It can bind to at least three additional proteins in a Ca(2+)-independent manner; these are neurexins, syntaxin and AP2. Plays a role in dendrite formation by melanocytes (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an alternate exon in the 5' UTR and uses a difference splice site in the coding region, compared to variant 1. The resulting protein (isoform 2) is shorter when it is compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.