Actr3 (NM_001205385) Mouse Untagged Clone

SKU
MC227590
Actr3 (untagged) - Mouse ARP3 actin-related protein 3 (Actr3), transcript variant 2
  $503.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Actr3
Synonyms 1200003A09Rik; Arp3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC227590 representing NM_001205385
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGGACGGCTGCCGGCCTGTGTGGTGGACTGTGGCACGGGATATACAAAACTAGGATATGCTGGAA
ATACAGAGCCACAGTTTATCATCCCATCATGTATTGCCATTAAAGAGTCTGCAAAAGTGGGTGACCAAGC
CCAGAGGAGGGTGATGAAAGGCGTGGATGACCTAGACTTCTTCATTGGTGATGAAGCAATAGAAAAGCCC
ACATATGCAACAAAGTGGCCAATTCGCCATGGTATAGTTGAAGACTGGGACTTAATGGAAAGGTTTATGG
AGCAAGTGATTTTTAAATATTTAAGGGCAGAACCTGAAGATCATTACTTTCTTTTGACTGAACCTCCACT
GAATACTCCAGAAAACAGGGAATATACTGCTGAAATAATGTTTGAATCCTTCAATGTTCCAGGCTTGTAC
ATTGCTGTGCAGGCTGTTCTTGCCTTAGCTGCATCCTGGACCTCAAGACAAGTAGGAGAGCGGACGCTGA
CGGGTACAGTAATAGACAGTGGAGACGGAGTCACTCATGTCATTCCTGTGGCTGAAGGATATGTTATCGG
CAGCTGTATTAAACACATTCCAATCGCAGGAAGAGATATAACATATTTTATTCAGCAACTGCTGCGAGAC
CGAGAAGTAGGAATCCCTCCTGAGCAGTCCTTGGAAACTGCGAAAGCAGTGAAGGAACGCTACAGTTATG
TCTGCCCAGATTTAGTAAAAGAGTTTAACAAGTATGACACCGATGGGTCAAAGTGGATCAAACAGTACAC
CGGAGTCAACGCCATCTCAAAGAAAGAGTTTTCTATTGATGTTGGCTATGAGCGATTCCTGGGACCCGAG
ATCTTTTTCCATCCAGAGTTTGCTAATCCAGATTTTACACAACCTATCTCAGAAGTTGTAGATGAAGTCA
TTCAGAATTGCCCCATTGATGTCCGGCGTCCTCTCTACAAGAACATTGTCCTCTCTGGTGGTTCAACCAT
GTTCAGGGACTTTGGACGTCGTTTGCAAAGAGATTTGAAGAGAACTGTAGATGCCAGGCTGAAGTTAAGC
GAGGAGCTGAGTGGTGGTAGATTGAAGCCCAAGCCTATTGATGTACAAGTTATTACACACCATATGCAGC
GGTATGCAGTCTGGTTTGGAGGGTCAATGCTGGCTTCCACGCCTGAGTTCTACCAAGTATGCCACACCAA
AAAGGATTATGAAGAAATTGGACCTAGCATTTGTCGTCACAATCCAGTGTTTGGAGTCATGTCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001205385
Insert Size 1257 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001205385.1, NP_001192314.1
RefSeq Size 2554 bp
RefSeq ORF 1257 bp
Locus ID 74117
UniProt ID Q99JY9
Cytogenetics 1 E2.3
Summary ATP-binding component of the Arp2/3 complex, a multiprotein complex that mediates actin polymerization upon stimulation by nucleation-promoting factor (NPF). The Arp2/3 complex mediates the formation of branched actin networks in the cytoplasm, providing the force for cell motility. Seems to contact the pointed end of the daughter actin filament. In addition to its role in the cytoplasmic cytoskeleton, the Arp2/3 complex also promotes actin polymerization in the nucleus, thereby regulating gene transcription and repair of damaged DNA. The Arp2/3 complex promotes homologous recombination (HR) repair in response to DNA damage by promoting nuclear actin polymerization, leading to drive motility of double-strand breaks (DSBs). Plays a role in ciliogenesis.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001205385" in other vectors (1)
SKU Description Size Price
MR229801 Actr3 (myc-DDK-tagged) - Mouse ARP3 actin-related protein 3 (Actr3), transcript variant 2 10 ug
$289.00 $457.00

Welcome to OriGene AI!

I'm your AI-powered guide to everything OriGene.
Ask me anything:

  • Product specs
  • Ordering help
  • Technical questions
  • How to find exactly what your experiment needs

Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.

Velaro Chat Img

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.