Tead2 (NM_001285500) Mouse Untagged Clone

SKU
MC227549
Tead2 (untagged) - Mouse TEA domain family member 2 (Tead2), transcript variant 3
  $503.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Tead2
Synonyms Etdf; ETF; TEAD-2; TEF-4; TEF4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC227549 representing NM_001285500
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGGATCCCCGGACTGGGGCCCCCCTGGATGATGGCGGGGGCTGGACAGGTAGCGAGGAAGGCAGCG
AAGAGGGCACCGGAGGCAGCGAGGGCGTTGGAGGTGATGGCAGCCCTGATGCAGAAGGCCGGAACGAACT
CATTGCCCGTTACATCAAGCTGAGGACAGGGAAGACGAGAACGCGAAAGCAGGTCTCCAGCCATATTCAG
GTTTTGGCTCGAAGGAAATCGAGAGAAATTCAGTCCAAGCTGAAGGACCAAGTCTCCAAGGACAAGGCCT
TCCAGACGATGGCCACCATGTCTTCGGCACAGCTCATCTCCGCCCCTTCCCTCCAGGCCAAGCTGGGCCC
TTCTGGCCCTCAGGCCACTGAGCTTTTCCAGTTCTGGTCAGGGAGCTCTGGGCCACCATGGAATGTTCCA
GACGTGAAGCCCTTCTCACAGGCACCGTTCTCCGTGTCACTGACGCCCCCAGCCTCTGACCTACCAGGGT
ACGAGCCGCCCCCAGCCCTCTCACCCCTGCCCCCACCCGCTCCGTCTCCCCCAGCCTGGCAGGCTCGGGC
CCTGGGCACTGCCCGCCTGCAGCTGATAGAGTTCTCAGCGTTTGTGGAACCGCCAGACGCAGTTGACTCG
TTCCAGAGGCATCTGTTTGTCCACATCAGTCAGCAGTGTCCCAGCCCTGGAGCACCACCCCTAGAGAGTG
TGGACGTGCGGCAGATCTACGACAAATTCCCTGAGAAGAAGGGCGGCCTCCGCGAGCTGTATGACCGAGG
GCCACCACATGCCTTCTTCCTCGTCAAGTTCTGGGCGGACCTGAACTGGGGCCCCAGTGCCGAGGAGGCA
GGGAGCAGCGGAGGTGGCGGTGGCTTCTATGGAGTGAGCAGCCAGTATGAGAGCCGGGAGCTCATGACAC
TCACCTGCTCCTCCAAGGTCTGCTCCTTTGGCAAGCAAGTGGTAGAGAAGGTGGAGACGGAACGGGCCCA
GCTGGAGGACGGGCGCTTTGTGTACCGTCTGCTGCGCTCTCCCATGTGTGAGTACCTGGTTAATTTCCTG
CACAAGCTCCGTCAGCTGCCTGAACGCTACATGATGAACAGTGTCCTGGAGAACTTCACCATCCTCCAGG
TTGTGACAAACAGGGACACTCAGGAACTGCTGCTGTGTACTGCCTACGTCTTTGAAGTCTCCACCAGTGA
ACGAGGAGCCCAGTACCACATCTACCGCCTGGTCAGGGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001285500
Insert Size 1233 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001285500.1, NP_001272429.1
RefSeq Size 2010 bp
RefSeq ORF 1233 bp
Locus ID 21677
Cytogenetics 7 29.19 cM
Summary Transcription factor which plays a key role in the Hippo signaling pathway, a pathway involved in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein MST1/MST2, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Acts by mediating gene expression of YAP1 and WWTR1/TAZ, thereby regulating cell proliferation, migration and epithelial mesenchymal transition (EMT) induction (By similarity). Binds to the SPH and GT-IIC 'enhansons' (5'-GTGGAATGT-3'). May be involved in the gene regulation of neural development. Binds to the M-CAT motif.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (3) differs in the 5' UTR and uses an alternate in-frame splice junction at the 3' end of an exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001285500" in other vectors (1)
SKU Description Size Price
MR229760 Tead2 (myc-DDK-tagged) - Mouse TEA domain family member 2 (Tead2), transcript variant 3 10 ug
$289.00 $457.00

Welcome to OriGene AI!

I'm your AI-powered guide to everything OriGene.
Ask me anything:

  • Product specs
  • Ordering help
  • Technical questions
  • How to find exactly what your experiment needs

Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.

Velaro Chat Img

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.