Snx5 (NM_001199188) Mouse Untagged Clone

CAT#: MC227515

Snx5 (untagged) - Mouse sorting nexin 5 (Snx5), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Snx5
• Synonyms: 0910001N05Rik; 1810032P22Rik; AU019504; D2Ertd52e
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC227515 representing NM_001199188
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCGCGGTTCCCGAGTTGCTGGAGCAGCAGGAGGAGGACCGCAGCAAGTTAAGATCTGTGTCTGTGG
  ACCTGAATGTTGACCCATCGCTTCAGATCGACATACCTGATGCACTCAGTGAGAGAGATAAGGTCAAGTT
  TACAGTGCACACCAAGACCACACTGTCCACATTTCAGAGCCCAGAGTTTTCTGTTACAAGGCAACATGAA
  GACTTTGTGTGGCTGCATGACACTCTTACTGAAACAACGGATTATGCTGGCCTTATTATCCCTCCTGCTC
  CTACAAAGCCAGACTTTGATGGCCCTCGAGAGAAGATGCAGAAACTGGGAGAAGGGGAAGGATCTATGAC
  AAAAGAAGAGTTTGCCAAGATGAAGCAAGAACTGGAAGCTGAGTATCTCGCTGTCTTTAAGAAGACTGTG
  TCCACCCATGAAGTCTTTCTTCAGCGGCTTTCTTCTCACCCTGTTCTCAGTAAAGACCGCAACTTTCATG
  TTTTCTTGGAATATGATCAGGATCTAAGTGTTAGACGGAAGAATACCAAGGAGATGTTTGGAGGCTTTTT
  TAAAAGTGTGGTGAAGAGCGCCGATGAGGTCCTTTTTTCTGGAGTTAAGGAGGTGGATGACTTCTTTGAG
  CAAGAGAAGAATTTCCTTATTAACTATTACAACAGGATCAAGGATTCCTGTGCTAAAGCAGACAAAATGA
  CCAGATCTCACAAAAATGTTGCTGACGACTATATCCACACTGCAGCCTGCTTGCATAGCCTGGCCTTGGA
  AGAACCCACAGTCATCAAAAAGTACCTGTTGAAAGTTGCAGAGCTATTTGAAAAACTTAGGAAAGTGGAA
  GGTCGAGTCTCATCAGATGAAGACTTAAAACTGACAGAGCTCCTCCGATACTACATGCTCAACATAGAGG
  CTGCAAAGGATCTCTTGTATAGACGTACCAAAGCCCTAATTGACTATGAGAATTCAAACAAAGCTTTGGA
  CAAGGCCCGGTTAAAAAGCAAAGATGTCAAGTTGGCAGAGACTCATCAGCAGGAATGCTGCCAGAAGTTT
  GAACAGCTTTCTGAATCTGCAAAAGAAGAGCTGATAAACTTCAAACGGAAGAGAGTGGCAGCATTTCGAA
  AGAACCTAATCGAAATGTCTGAACTGGAAATAAAGCATGCCAGAAACAACGTCTCCCTGTTGCAGAGCTG
  CATCGACTTATTCAAGAACAACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199188
• Insert Size: 1215 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199188.1, NP_001186117.1
• RefSeq Size: 2508 bp
• RefSeq ORF: 1215 bp
• Locus ID: 69178
• UniProt ID: Q9D8U8
• Cytogenetics: 2 70.98 cM
• Gene Summary: Involved in several stages of intracellular trafficking. Interacts with membranes containing phosphatidylinositol lipids. Acts in part as component of the retromer membrane-deforming SNX-BAR subcomplex. The SNX-BAR retromer mediates retrograde transport of cargo proteins from endosomes to the trans-Golgi network (TGN) and is involved in endosome-to-plasma membrane transport for cargo protein recycling. The SNX-BAR subcomplex functions to deform the donor membrane into a tubular profile called endosome-to-TGN transport carrier (ETC). Does not have in vitro vesicle-to-membrane remodeling activity. Involved in retrograde transport of lysosomal enzyme receptor IGF2R. May function as link between endosomal transport vesicles and dynactin. Plays a role in the internalization of EGFR after EGF stimulation. Involved in EGFR endosomal sorting and degradation; the function involves PIP5K1C and is retromer-independent. Together with PIP5K1C facilitates HGS interaction with ubiquitinated EGFR, which initiates EGFR sorting to intraluminal vesicles (ILVs) of the multivesicular body for subsequent lysosomal degradation. Involved in E-cadherin sorting and degradation; inhibits PIP5K1C-mediated E-cadherin degradation (By similarity). Plays a role in macropinocytosis (PubMed:18854019).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.