Nlrc3 (NM_175547) Mouse Untagged Clone

CAT#: MC227484

Nlrc3 (untagged) - Mouse NLR family, CARD domain containing 3 (Nlrc3), transcript variant 2

  View "NM_175547" in other vectors (1)

USD 390.00


Availability*
2 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Nlrc3 (NM_175547) Mouse Untagged Clone
Symbol Nlrc3
Synonyms CLR16.2; D230007K08Rik; mFLJ00348
Vector pCMV6-Entry
Sequence Data
>MC227484 representing NM_175547
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGGAAGCCTGGCTGAGAATCAGATTGGTAACAAAGGAGCCAAAGCCCTGGCCAGATCCCTCCTGG
TTAACAGAAGCCTCATCACACTGGACCTCCGGAGTAACAGCATTGGACCACCGGGGGCTAAGGCTTTGGC
CGATGCTCTGAAGATAAACCGAACGCTAACTTCTCTAAGCCTCCAAAGCAACGTGATCAAGGATGACGGT
GTCATGTGCGTGGCTGAGGCCCTGGTCTCCAACCAGACCATCTCCATGCTACAGCTACAGAAGAACTTAA
TTGGGCTCATAGGAGCCCAGCAGATGGCAGATGCCCTGAAGCAGAACAGGAGCCTGAAAGCACTCATGTT
TTCCAGTAATACCATTGGCGACAGAGGTGCCATAGCCCTGGCTGAGGCCCTGAAGGTGAACCAGATCCTG
GAGAACTTAGACCTACAGAGCAATTCCATCAGTGACATGGGAGTGACGGTGCTGATGCGAGCCCTCTGCA
GTAACCAGACACTCTCCAGTCTCAACCTGCGAGAAAACTCCATCAGCCCAGAGGGAGCCCAGGCCCTCAC
TCAAGCTCTCTGCAGGAACAACACTCTGAAGCACTTGGACCTGACAGCTAATCTCCTCCATGACCGAGGT
GCCCAGGCCATTGCAGTAGCTGTGGGAGAAAACCACTCCCTCACACACCTTCACCTGCAGTGGAACTTCA
TCCAAGCTGGTGCGGCCAGGGCCCTGGGACAAGCACTCCAGCTGAACAGAACCCTGACAACCTTAGACTT
ACAGGAGAATGCCATAGGGGATGAAGGAGCTTCCTCAGTGGCTGGCGCACTGAAGGTGAACACAACCCTC
ATTGCTCTCTACCTACAGGTGGCCTCCATTGGTAGCCAAGGGGCCCAGGCACTTGGGGAGGCCCTCACTG
TGAACAGAACCTTGGAGATTCTTGACTTACGAGGAAACGACGTTGGGGCAGCTGGAGCCAAGGCCTTGGC
AAATGCTTTAAAGTTAAACTCCAGTCTCCGAAGACTCAATCTCCAGGAGAACTCACTGGGGATGGATGGG
GCCATATTTGTTGCCTCTGCACTGTCTGAGAACCACGGTCTGCACCATATTAATCTCCAGGGGAATCCCA
TTGGGGAGTCTGCTGCCAGGATGATCTCAGAGGCCATCAAGACAAACGCTCCCACATGCACTGTGGAAAT
ATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_175547
ORF Size 1194 bp
Insert Size 1194
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_175547.3, NP_780756
RefSeq Size 2003
RefSeq ORF 1194
Locus ID 268857
Cytogenetics 16|16 A1

Other Versions

Other products for "Nlrc3"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies