OriGene Logo

Fetub (NM_001083905) Mouse Untagged Clone

Be the first to review this product
SKU
MC227442
Fetub (untagged) - Mouse fetuin beta (Fetub), transcript variant 3
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free DDK
AAV Particle:
DDK
  $503.00
2 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Fetub or NM_001083905"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Fetub
Synonyms 2310011O17Rik; AI255764; D17980; Gugu
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC227442 representing NM_001083905
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCCTGCTCCGACTTCTGGTGCTCTGCACCCTGGCTGCATGCTGCATGGCCCGCTCTCCCCCAGCCC
CACCCCTGCCACAACGCCCCCTCTCACCTCTGCATCCTCTGGGCTGTAACGACTCTGAAGTGCTGGCAGT
TGCAGGATTTGCCCTGCAGAACATCAACAGAGACCAAAAGGATGGCTATATGTTGAGCCTTAACAGAGTG
CATGATGTTCGGGAGCACTACCAGGAAGACATGGGATCTCTGTTCTACCTCACATTGGATGTCTTAGAGA
CTGACTGCCACGTGCTCAGCAGGAAGGCACAGAAGGACTGCAAACCGAGGATGTTCTATGAGTCGGTTTA
TGGCCAGTGCAAAGCAATGTTTCACATTAACAAGCCAAGAAGAGTTCTCTACTTACCTGCTTATAACTGT
ACACTTCGCCCAGTTTCCAAAAGAAAGACTCATACAACGTGCCCTGACTGCCCTAGCCCCATTGACTTGT
CAAACCCCAGTGCTCTGGAAGCTGCCACGGAGTCGCTTGCAAAGTTCAACAGTAAGAGCCCCTCAAAAAA
GTATGAACTCGTCAAAGTCACCAAGGCTATGAACCAGTGGGTGTCTGGCCCTGCTTACTATGTGGAATAT
TTGATCAAAGAGGCACCATGTACCAAATCCCAGGCCAGCTGTTCGCTCCAGCACTCTGACTCTGAGCCCG
TTGGTATTTGCCAAGGTTCTACGGTCCAAAGTTCTCTGAGGCACGTTCCTCTGATCCAACCCGTAGAAAA
GTCTGTCACTGTGACTTGTGAGTTCTTCGAATCTCAGGCTCAGGTCCCTGGAGATGAGAACCCTGCTGTT
ACCCAGGGCCCTCAGAAACTCCCTCAGAAAAACACGGCCCCTACCAGCTCCCCCTCCGTAACTGCACCAA
GAGGATCCATCCAGCACCTCCCCGAACTGGATGATGAGAAGCCCGAGGAGTCCAAGGGAGGGAGCCCTGA
GGAAGCCTTTCCTGTGCAGCTGGATCTAACCACCAATCCCCAGGGGGACACACTAGATGTCTCCTTCCTG
TACCTGGAGCCTGGGGACAAGAAGCTGGTGGTGCTGCCTTTCCCTGGAAAGGAACAGCGCTCCGCCGAGT
GCCCAGGGCCCGAGAAGGAGAACAACCCTCTGGTTCTCCCACCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001083905
Insert Size 1167 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001083905.1, NP_001077374.1
RefSeq Size 1535 bp
RefSeq ORF 1167 bp
Locus ID 59083
UniProt ID Q9QXC1
Cytogenetics 16 13.76 cM
Summary Protease inhibitor required for egg fertilization. Required to prevent premature zona pellucida hardening before fertilization, probably by inhibiting the protease activity of ASTL, a protease that mediates the cleavage of ZP2 and triggers zona pellucida hardening.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1 and 3 encode the same protein (isoform 1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001083905" in other vectors (1)
SKU Description Size Price
MR229653 Fetub (myc-DDK-tagged) - Mouse fetuin beta (Fetub), transcript variant 3 10 ug
$289.00 $457.00

Welcome to OriGene AI!

I'm your AI-powered guide to everything OriGene.
Ask me anything:

  • Product specs
  • Ordering help
  • Technical questions
  • How to find exactly what your experiment needs

Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.

Velaro Chat Img

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.