Ikzf1 (NM_001301866) Mouse Untagged Clone

CAT#: MC227439

Ikzf1 (untagged) - Mouse IKAROS family zinc finger 1 (Ikzf1), transcript variant 5


  "NM_001301866" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Ikzf1 Antibody - N-terminal region
    • 100 ul

USD 539.00

Other products for "Ikzf1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ikzf1
Synonyms 5832432G11Rik; hlk-1; I; Ikaros; LyF-; LyF-1; mKIAA4227; Zfpn; Zfpn1a1; Znfn1a1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227439 representing NM_001301866
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGTCGATGAGGGTCAAGACATGTCCCAAGTTTCAGGAAAGGAGAGCCCCCCAGTCAGTGACACTC
CAGATGAAGGGGATGAGCCCATGCCTGTCCCTGAGGACCTGTCCACTACCTCTGGAGCACAGCAGAACTC
CAAGAGTGATCGAGGCATGGGTGAACGGCCTTTCCAGTGCAACCAGTGTGGGGCCTCCTTTACCCAGAAA
GGCAACCTCCTGCGGCACATCAAGCTGCACTCGGGTGAGAAGCCCTTCAAATGCCATCTTTGCAACTATG
CCTGCCGCCGGAGGGACGCCCTCACCGGCCACCTGAGGACGCACTCCGTCATTAAGGAAGAAACTAACCA
CAACGAGATGGCAGAAGACCTGTGCAAGATAGGAGCAGAGAGGTCCCTTGTCCTGGACAGGCTGGCAAGC
AATGTCGCCAAACGTAAGAGCTCTATGCCTCAGAAATTTCTTGGAGACAAGTGCCTGTCAGACATGCCCT
ATGACAGTGCCAACTATGAGAAGGAGGATATGATGACATCCCACGTGATGGACCAGGCCATCAACAATGC
CATCAACTACCTGGGGGCTGAGTCCCTGCGCCCATTGGTGCAGACACCCCCCGGTAGCTCCGAGGTGGTG
CCAGTCATCAGCTCCATGTACCAGCTGCACAAGCCCCCCTCAGATGGCCCCCCACGGTCCAACCATTCAG
CACAGGACGCCGTGGATAACTTGCTGCTGCTGTCCAAGGCCAAGTCTGTGTCATCGGAGCGAGAGGCCTC
CCCGAGCAACAGCTGCCAAGACTCCACAGATACAGAGAGCAACGCGGAGGAACAGCGCAGCGGCCTTATC
TACCTAACCAACCACATCAACCCGCATGCACGCAATGGGCTGGCTCTCAAGGAGGAGCAGCGCGCCTACG
AGGTGCTGAGGGCGGCCTCAGAGAACTCGCAGGATGCCTTCCGTGTGGTCAGCACGAGTGGCGAGCAGCT
GAAGGTGTACAAGTGCGAACACTGCCGCGTGCTCTTCCTGGATCACGTCATGTATACCATTCACATGGGC
TGCCATGGCTTTCGGGATCCCTTTGAGTGTAACATGTGTGGTTATCACAGCCAGGACAGGTACGAGTTCT
CATCCCATATCACGCGGGGGGAGCATCGTTACCACCTGAGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301866
Insert Size 1164 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301866.1, NP_001288795.1
RefSeq Size 4736 bp
RefSeq ORF 1164 bp
Locus ID 22778
Cytogenetics 11 7.02 cM
Gene Summary The protein encoded by this gene belongs to a family of transcription factors that are characterized by a set of four DNA-binding zinc fingers at the N-terminus and two C-terminal zinc fingers involved in protein dimerization. It is regulated by both epigenetic and transcription factors. This protein is a transcriptional regulator of hematopoietic cell development and homeostasis. In addition, it is required to confer temporal competence to retinal progenitor cells during embryogenesis, demonstrating an essential function in nervous system development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (5) differs in the 5' UTR and lacks in-frame exons in the coding region compared to variant 1. It encodes isoform c, which is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.