Asmt (NM_001199212) Mouse Untagged Clone

CAT#: MC227437

Asmt (untagged) - Mouse acetylserotonin O-methyltransferase (Asmt)


  "NM_001199212" in other vectors (1)

Reconstitution Protocol

USD 503.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Asmt"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Asmt
Synonyms Hio; Hiomt
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227437 representing NM_001199212
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCACAGGGGCCGCTCGGCCTCCGCCCGCCAGGAGCGCGACTTCCGGGCCCTCATGGACCTGGCCCACG
GCTTCATGGCCTCCCAGGTGCTGTTCGCGGGCTGCGCGCTCCGCGTGTTCGACGCCGCGGCCCTGGGCCC
CGTGGACGCCGCGGCGCTGGCGAGGTCGTCGGGCCTGAGCCCCCGGGGGACGCGGCTGCTGCTCGACGCC
TGCGCGGGGCTGGGGCTGCTGCGGAGACGCAGGGGGGCGGGGCCTCGCGGCCCCGCCTACACCAACTCCC
CCCTGGCGTCCACCTTCCTGGTCGCGGGCAGCCCCCTGTCTCAGCGCAGCCTCCTGCTCTACCTGGCGGG
CACCACCTACCTGTGCTGGGGGCACCTGGCGGACGGCGTGAGGGAAGGGCGGAGCCAGTACGCGAGGGCC
GTGGGCGTCGACGCGGACGACCCCTTCACCGCCATCTACAGGTCGGAGGCCGAGCGCCTGCTGTTCATGC
GGGGCCTGCAGGAGACCTGGAGCCTGTGCGGGGGGCGGGTCCTCACGGCCTTCGACCTCTCGCCCTTCAG
GGTCATCTGCGACCTCGGTGGTGGGTCCGGGGCGCTGGCCCGCATGGCCGCCCGGCTCTACCCGGGCAGC
GAGGTCACCGTGTTCGAGACGCCCGACGTCGTCGCCGCCGCCCGCGCCCACTTCCCGCCCCCAGCGGACG
AGGACGGGGCGGAGCCTCGTGTGCGCTTCCTGTCAGGCGACTTCTTCCGCTCGCCGCTGCCGCCCGCCGA
CCTCTACGTCCTGGCCCGGGTCCTGCACGACTGGGCGGACGCCGCCTGCGTGGAGCTGCTGCGGCGCGTG
CGGGGCGCCCTGCGGCCAGGCGGCGCGGTGCTGCTGGTGGAGAGCGTGCTGTCCCCGGGAGGGGCGGGGC
CGACGCGGACGCTGCTGCTGTCGCTCACGATGCTGCTGCAGGCCCGGGGCCGCGAGCGCACGGAGGCCGA
GTACCGGGCGCTGACCGCGCGCGCCGGCTTCTCCCGCCTGCGGCTGCGGCGCCCGCGGGGCCCCTACCAC
GCCATGATGGCCGCCCGGGGGGGCGGGGCCGGGGCGCGGAGCGACGGCGGCGGCGGGGACGCGACGTCAC
AGACAGGAAGTGGGACAGGAAGTGAGGTCGGCGCCCAGGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001199212
Insert Size 1164 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199212.1, NP_001186141.1
RefSeq Size 1273 bp
RefSeq ORF 1164 bp
Locus ID 107626
UniProt ID D3KU66
Cytogenetics X
Gene Summary This gene belongs to the methyltransferase superfamily and is located in the pseudoautosomal region (PAR) of the X and Y chromosomes. The encoded enzyme catalyzes the final reaction in the synthesis of melatonin and is abundant in the pineal gland. Two amino acid substitutions (R78G and R242C) are present in the encoded protein derived from the reference strain, C57BL/6J, and this protein shows low enzyme activity relative to the protein derived from other strains. [provided by RefSeq, May 2015]
Transcript Variant: This variant (1) is based on a transcript from the C3H/HeJ strain and encodes an isoform (1) with high enzyme activity.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.