Selenop (NM_001042613) Mouse Untagged Clone

SKU
MC227396
Sepp1 (untagged) - Mouse selenoprotein P, plasma, 1 (Sepp1), transcript variant 2
  $732.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Selenop
Synonyms AU018766; D15Ucl; D15Ucla1; s; Se; Se-P; selp; Sepp1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC227396 representing NM_001042613
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGGAGAAGCCTAGGGCTTGCCCTGGCTCTCTGTCTCCTCCCCTATGGAGGAGCAGAGAGCCAAGGCC
AAAGCTCTGCTTGTTACAAAGCCCCGGAGTGGTACATAGGAGATCAAAATCCAATGCTAAACTCAGAGGG
CAAAGTGACAGTGGTTGCTCTTCTTCAAGCCAGCTGATACTTGTGTCTTCTGCAGGCATCCAGATTGGAA
GACCTGCGCATAAAACTAGAAAGCCAAGGATATTTTAACATCTCTTACATTGTTGTTAACCATCAAGGAT
CTCCTTCCCAATTAAAACACTCACATCTTAAAAAGCAGGTGTCAGAACACATCGCAGTGTACAGACAAGA
AGAAGATGGCATAGATGTCTGGACTCTCTTAAATGGAAACAAAGATGACTTCCTCATCTATGACAGATGT
GGCCGTCTTGTGTATCACCTTGGTTTGCCTTACTCCTTCCTCACATTCCCATATGTTGAAGAAGCCATTA
AGATCGCTTACTGTGAGGAGAGGTGCGGAAACTGCAATCTCACGAGTCTTGAAGATGAAGACTTCTGTAA
AACTGTGACCTCAGCTACTGCCAATAAAACTGCGGAGCCCTCAGAGGCTCATAGCCACCACAAACACCAC
AACAAACATGGGCAGGAGCATCTTGGCAGCAGTAAGCCTTCAGAGAATCAGCAACCAGGGCCATCAGAGA
CGACTCTGCCTCCTTCAGGCTTGCACCACCACCACAGGCATAGGGGCCAGCACAGGCAGGGTCACTTAGA
GAGCTGAGACACCACAGCAAGTGAAGGCTTGCACCTTTCACTTGCCCAGAGGAAGCTCTGACGAAGGGGG
TGCATCAACCAGCTCCTGTGTAAGTTGTCTAAGGAGTCCGAGGCAGCCCCCAGCAGCTGCTGCTGTCACT
GCCGCCACCTCATATTTGAGAAGTCAGGGTCTGCAATTGCTTGACAGTGTGCGGAAAACCTCCCATCCTT
ATGTAGCTGACAGGGGCTTTTCGCGGAGGAGAAAGTCACTGAATCCTGTCAGTGTAGGTCACCTCCAGCT
GCCTGACAAAATCAGCCCATGAACCCCATGGAAGCCAACCCCAACTGAAGCTGAGATAATCAGACCAGGA
AGTGAAAATGACATTCAAACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001042613
Insert Size 1143 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001042613.1, NP_001036078.1
RefSeq Size 2013 bp
RefSeq ORF 1143 bp
Locus ID 20363
UniProt ID P70274
Cytogenetics 15 1.84 cM
Summary This gene encodes a selenoprotein that is predominantly expressed in the liver and secreted into the plasma. This selenoprotein is unique in that it contains multiple selenocysteine (Sec) residues per polypeptide (10 in mouse), and accounts for most of the selenium in plasma. It has been implicated as an extracellular antioxidant, and in the transport of selenium to extra-hepatic tissues via apolipoprotein E receptor-2 (apoER2). Mice lacking this gene exhibit neurological dysfunction, suggesting its importance in normal brain function. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. The mRNA for this selenoprotein contains two SECIS elements. Alternatively spliced transcript variants differing in 5' non-coding region have been described for this gene. Expression of these variants varies in different tissues and developmental stages (PMID:23064117). provided by RefSeq, Feb 2017
Transcript Variant: This variant (2, also known as Sepp1b) uses an alternate 5' non-coding exon, hence has a different 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein containing 10 selenocysteine residues. Variant Sepp1b is specifically localized to the hippocampus in the brain, and is a specific target for regulation by miR-7 microRNA (PMID:23064117).
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001042613" in other vectors (2)
SKU Description Size Price
MG205928 Sepp1 (GFP-tagged) - Mouse selenoprotein P, plasma, 1 (Sepp1), transcript variant 2, (Note, selenocysteine protein, internal stop codon, see summary) 10 ug
$598.00
MR229607 Sepp1 (myc-DDK-tagged) - Mouse selenoprotein P, plasma, 1 (Sepp1), transcript variant 2 10 ug
$398.00

Welcome to OriGene AI!

I'm your AI-powered guide to everything OriGene.
Ask me anything:

  • Product specs
  • Ordering help
  • Technical questions
  • How to find exactly what your experiment needs

Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.

Velaro Chat Img

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.