Gm10352 (NM_001270511) Mouse Untagged Clone

CAT#: MC227390

Gm10352 (untagged) - Mouse predicted gene 10352 (Gm10352)

USD 361.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gm10352 (NM_001270511) Mouse Untagged Clone
Symbol Gm10352
Synonyms ENSMUSG00000071960
Vector pCMV6-Entry
Sequence Data
>MC227390 representing NM_001270511
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGAAACTGATCAGCCTGGGAAAATTTTTATAGGAGGCCTCAACATAAAGACCAGACAAAAGACTC
TTCAAGAAATATTTGGGAGATTTGGACCAGTAGCACGTGTTATTTTGATGAGAGATCGTGAAACTAAGAA
GTCTAGAGGCTTTGCTTTCCTTACTTTCCGACGCCTTGCAGATGCTAAGAATGCTGTCAAAGAAATGAAT
GGAGTGATTTTGGATGGAAAAAGAATTAAAGTAAAACAAGCCAGGAGACCATCATCACTTGAAAGTGGTA
GCAAGAAGAGACCACCATCCTTTTCAAGAACCAGAGGTGCTTCAAGAATTCTGAAATGTGGAAGAGGAGG
AAGAAGCAGAGCAAGAAGTGGTCCTTCATGTGAAGGGAACTTGGGTGGTGATAGATATACTCCTAATTTC
AATGTGAGTTCTTCTGGGAGACACTTTGCAGTTAAAAGAAATCCATCTTCAAAAAGGGATGATCCCCCTT
CTAAAAGATCTGCAACTTCTGCTCAGACAAGAAGCAATACTGGACTAAGAGGACGAGAACCACATCGAAG
AGAGATTTCTAGAAATATGCCAAGAGGAGAGCCGGCGTCTTCCAGAAGAGATGAGTATCCATTACCAAGG
GATTATGGCCAGTCTTCTAATGATAGGAAATATGAATCAACATCCAGAGGATACTGTGACTATGGCAATT
ACCACTCTCGGGAAGAAAGTGCATCTAAAGTCTTCAGTGATCATGCTGGCTATCTTGGAGGACGTGATAG
AGATTTCTCTGAATATTTAAGTGGAAATTCATACAGAGATACATACAGAAGTTATGGAAGATTCCATGAG
GCACCATCTGCAAGAGGTGGAAACAACCGCTATGATGACTATAGTAACTCACAAGATGGATATGGTGGAA
GAGGAGAACCATACATAAGCAACCGAAGTAACATATACTCAAGTGACTATGAACGTAGTGGTAGACAAGA
AGTGCTTCCACCACCTATTGATAGGGAATACTTTGACCGTGAGGGCAGACAGGAAAGAGGGCATTCACCT
AAGGATGGGCTGTATAGTGCATCTCGTGAATCATACAGTAGTAATACCAAGATTTGGGGGATCCCATGGA
GGTCGTGGAGAAAGCAGATATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001270511
ORF Size 1143 bp
Insert Size 1143
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001270511.1, NP_001257440
RefSeq Size 1580
RefSeq ORF 1143
Locus ID 100042881
Cytogenetics Y A1|Y
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.